ID: 1099086383

View in Genome Browser
Species Human (GRCh38)
Location 12:78251683-78251705
Sequence CTGGAGCCACACTGCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099086379_1099086383 -3 Left 1099086379 12:78251663-78251685 CCTGGGTCCTGGATGATCTCCTG No data
Right 1099086383 12:78251683-78251705 CTGGAGCCACACTGCCAGCTTGG No data
1099086381_1099086383 -10 Left 1099086381 12:78251670-78251692 CCTGGATGATCTCCTGGAGCCAC No data
Right 1099086383 12:78251683-78251705 CTGGAGCCACACTGCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099086383 Original CRISPR CTGGAGCCACACTGCCAGCT TGG Intergenic
No off target data available for this crispr