ID: 1099093150

View in Genome Browser
Species Human (GRCh38)
Location 12:78338933-78338955
Sequence GATATGCACTGTGATGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099093148_1099093150 -8 Left 1099093148 12:78338918-78338940 CCTCTGCCATCTGCTGATATGCA No data
Right 1099093150 12:78338933-78338955 GATATGCACTGTGATGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099093150 Original CRISPR GATATGCACTGTGATGTATC TGG Intergenic
No off target data available for this crispr