ID: 1099095058

View in Genome Browser
Species Human (GRCh38)
Location 12:78364988-78365010
Sequence ATGCTGTTATTAAAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099095058_1099095059 -2 Left 1099095058 12:78364988-78365010 CCTTTTATCTTTAATAACAGCAT No data
Right 1099095059 12:78365009-78365031 ATCCATCTAATGACACAATATGG No data
1099095058_1099095061 15 Left 1099095058 12:78364988-78365010 CCTTTTATCTTTAATAACAGCAT No data
Right 1099095061 12:78365026-78365048 ATATGGATTTTGCCAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099095058 Original CRISPR ATGCTGTTATTAAAGATAAA AGG (reversed) Intergenic
No off target data available for this crispr