ID: 1099096496

View in Genome Browser
Species Human (GRCh38)
Location 12:78380307-78380329
Sequence AAACACAACCTAGAATTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099096490_1099096496 -8 Left 1099096490 12:78380292-78380314 CCTTCCTCCTTCCCCAAACACAA No data
Right 1099096496 12:78380307-78380329 AAACACAACCTAGAATTATGTGG No data
1099096489_1099096496 -3 Left 1099096489 12:78380287-78380309 CCAAACCTTCCTCCTTCCCCAAA No data
Right 1099096496 12:78380307-78380329 AAACACAACCTAGAATTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099096496 Original CRISPR AAACACAACCTAGAATTATG TGG Intergenic
No off target data available for this crispr