ID: 1099101011

View in Genome Browser
Species Human (GRCh38)
Location 12:78440094-78440116
Sequence AGGGAGAGCAAAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099101011_1099101020 24 Left 1099101011 12:78440094-78440116 CCCACAGTCACTTTGCTCTCCCT No data
Right 1099101020 12:78440141-78440163 CCATGCCATGCCGCTACTGCTGG No data
1099101011_1099101022 26 Left 1099101011 12:78440094-78440116 CCCACAGTCACTTTGCTCTCCCT No data
Right 1099101022 12:78440143-78440165 ATGCCATGCCGCTACTGCTGGGG No data
1099101011_1099101021 25 Left 1099101011 12:78440094-78440116 CCCACAGTCACTTTGCTCTCCCT No data
Right 1099101021 12:78440142-78440164 CATGCCATGCCGCTACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099101011 Original CRISPR AGGGAGAGCAAAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr