ID: 1099101203

View in Genome Browser
Species Human (GRCh38)
Location 12:78442785-78442807
Sequence ATGTAACCACTGATGAAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099101203 Original CRISPR ATGTAACCACTGATGAAGTT AGG Intergenic
900635234 1:3660869-3660891 ATGTAACTGATGAGGAAGTTTGG + Intronic
906386536 1:45373933-45373955 ATGATACCACTTATCAAGTTAGG + Intronic
909984474 1:82143799-82143821 ATATAATCACTGATGTGGTTTGG + Intergenic
910549449 1:88459613-88459635 ATGAAGACACTGATGAAGGTGGG - Intergenic
912729093 1:112085937-112085959 ACGTACCCACTGAGGAAGTTTGG - Intergenic
915791280 1:158674335-158674357 ATGAAGCCTCTGATGAAGTTCGG - Exonic
916953982 1:169812430-169812452 AGGTACCCAGTGATGAAGTCAGG + Intronic
917012075 1:170486227-170486249 ATGCAATTACTGATGTAGTTGGG - Intergenic
917108554 1:171520433-171520455 ATATAATCACTGATGAAAGTGGG - Intronic
917119035 1:171629698-171629720 TTGAAGCCAGTGATGAAGTTAGG + Intergenic
918698257 1:187572981-187573003 ATGTAATCACTGATGTATTTGGG - Intergenic
919708544 1:200703209-200703231 ATGTTACCACTGGGGAAATTGGG + Intergenic
1062892024 10:1069848-1069870 ATGTAACCACTGGGGAAATATGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1065195470 10:23260829-23260851 ATGCAACCACTGGAAAAGTTAGG - Intergenic
1065541396 10:26772579-26772601 CTTTAACCTCTTATGAAGTTCGG + Intronic
1068264103 10:54625218-54625240 ATGTAACCATTGAGAAAGATAGG - Intronic
1071195338 10:83153203-83153225 ATCTAATCACTGATTGAGTTTGG - Intergenic
1072250866 10:93581466-93581488 ATGTTCCCACTGACAAAGTTGGG - Intronic
1077758865 11:5068198-5068220 TAGTCACCACTGATGAAATTAGG + Intergenic
1078429627 11:11278983-11279005 ATGTACCCATTGATGTAGTCTGG + Intronic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1080785554 11:35472055-35472077 AAGTAAACACTGATGAAACTCGG - Intronic
1081478615 11:43462024-43462046 ATGTAACTACTGATGTGCTTGGG - Intronic
1085820072 11:79782997-79783019 TTGTAACCACAGGTGATGTTGGG + Intergenic
1086152910 11:83632484-83632506 CAGTCAGCACTGATGAAGTTTGG + Intronic
1087639444 11:100740772-100740794 ATTCAACCACTGTTAAAGTTTGG + Intronic
1088286256 11:108191572-108191594 ATGAAACCCATGCTGAAGTTAGG + Intronic
1091592676 12:1854272-1854294 TTGTAACATCTGATGAACTTAGG + Intronic
1093867289 12:24243994-24244016 AGGTAACCACTGATCACGTTAGG + Intergenic
1096211287 12:49767927-49767949 ATCAAACCTCTGATGAAGCTGGG + Intergenic
1097405586 12:59185488-59185510 ATGTCACCACTGAGGAGGCTGGG + Intergenic
1097725333 12:63069314-63069336 AATTAACCACTTATGGAGTTGGG - Intergenic
1098131876 12:67359653-67359675 ATTTAACCACTCATGATGTCAGG + Intergenic
1098329388 12:69336818-69336840 ATGTAACCACTCAACAAATTTGG - Intergenic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1101567271 12:105920057-105920079 TTCTAACCAGTCATGAAGTTTGG - Intergenic
1102642815 12:114381828-114381850 AACTAACCACTGATGAAGTTGGG - Intronic
1104295051 12:127504370-127504392 ATCTGACTACTGGTGAAGTTGGG + Intergenic
1107131187 13:36897800-36897822 ATGTTTCCACTAATGAACTTTGG - Intronic
1108008746 13:45980982-45981004 ATGTTAACACTGGAGAAGTTGGG + Intronic
1108191883 13:47950188-47950210 TTGTGACCATTGAGGAAGTTAGG - Intronic
1108386581 13:49904651-49904673 ATGTAACCAGGGATGATGGTGGG + Intergenic
1110535635 13:76647717-76647739 ATGGAACCCCTGAAGAATTTGGG - Intergenic
1112036531 13:95501786-95501808 ATGTAATCACTGATATAGTTGGG + Intronic
1112626685 13:101112572-101112594 ATTTTACCAATGAGGAAGTTAGG - Intronic
1113525357 13:110970483-110970505 ATGGATCCCCTGATGTAGTTGGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1114956733 14:27830255-27830277 ATGTAACCACTGGGGAAACTAGG - Intergenic
1115195388 14:30793101-30793123 AGGTAACCACTATTGAGGTTAGG - Intergenic
1115934977 14:38542269-38542291 TTGTCACCACTGATACAGTTAGG - Intergenic
1117168267 14:53062387-53062409 ATGTAACTAGAGATGAAGATAGG + Intronic
1119921736 14:78452936-78452958 AATTAACCATTGATGGAGTTGGG + Intronic
1120491725 14:85186588-85186610 ATGTAATCACTGATGATATAGGG + Intergenic
1127156121 15:56126550-56126572 ATGTAATTACTGATAAAGTAAGG - Intronic
1127359889 15:58236187-58236209 ATTTAAACACTGATATAGTTTGG + Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1129794542 15:78366191-78366213 ATCTAACGACTGATGAACATGGG + Intergenic
1130364002 15:83216834-83216856 ATGTAGCCACTGATTTATTTGGG - Intergenic
1130603469 15:85294138-85294160 AGTTACCCACTGATGTAGTTTGG - Intergenic
1135685789 16:24497434-24497456 ATATAACCACGGATATAGTTTGG + Intergenic
1137917818 16:52452173-52452195 ATGTAACCATTGTTAATGTTAGG - Intronic
1138064005 16:53921414-53921436 ATTGAGCCACTGATGATGTTTGG - Intronic
1139028038 16:62843555-62843577 ATGTTATCAGTGTTGAAGTTCGG - Intergenic
1144193301 17:12866454-12866476 ATGCAGCCACACATGAAGTTAGG - Intronic
1145850343 17:28087827-28087849 CTGTAACCCATGATGAAGTTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148917439 17:50994062-50994084 ATACAACCACTGATGTGGTTTGG + Intronic
1149172588 17:53829198-53829220 ATGTAACTACTGATAGATTTAGG + Intergenic
1149244816 17:54693193-54693215 ATGTAACCAGTGATGAGGGAGGG - Intergenic
1149403172 17:56319830-56319852 ATGTAAATAATTATGAAGTTCGG - Intronic
1149787254 17:59446409-59446431 ATGTAATCATTGATTCAGTTTGG + Intergenic
1149926936 17:60710768-60710790 AAGTCACTTCTGATGAAGTTTGG + Intronic
1151993353 17:77592964-77592986 ATGTAACCAAAGATAAAGTAAGG + Intergenic
1154328561 18:13410398-13410420 ATGTAAACACTGGAGAAGGTGGG + Intronic
1157020772 18:43778923-43778945 ATGTAACCAGAGATGAAACTAGG + Intergenic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1159812401 18:73031160-73031182 ATGAATCCACTGATTTAGTTGGG + Intergenic
1160549531 18:79684681-79684703 AAATAACCACTGATGTGGTTAGG - Intronic
1162659920 19:12160873-12160895 ATAAAACCACTAATGAAGGTCGG - Intergenic
1164708364 19:30336899-30336921 AACTAATCACTAATGAAGTTTGG - Intronic
1165302057 19:34976538-34976560 ATGAAACCACTGATGCCATTTGG + Intergenic
925827083 2:7859820-7859842 CTGTGACCATTGATGTAGTTTGG - Intergenic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
926925397 2:17982117-17982139 ATTTAGCCACTGATGAAATCGGG - Intronic
928607302 2:32954598-32954620 ATGTGACCACTGTTGGAGATAGG - Intronic
929846421 2:45533733-45533755 ATGTAGCAATTGATGAACTTTGG - Intronic
934480549 2:94637736-94637758 ATGTAACCACTGGGGAAACTAGG + Intergenic
935174066 2:100632624-100632646 ATGTTACCACTGGGGAAGCTGGG - Intergenic
938671702 2:133592873-133592895 ATCTAGCCCCTGATGAAGCTGGG - Intergenic
940673604 2:156701767-156701789 ATTTAACCACAGAGGAAGTGAGG + Intergenic
941192762 2:162406936-162406958 TTGTAACCACTGATCATGATAGG + Intronic
941498618 2:166240138-166240160 ATTTTACCAATGATGAAGCTGGG - Intronic
943475431 2:188348720-188348742 ATGTTACCACTGGAGAAGCTGGG - Intronic
944086139 2:195850096-195850118 ATGTTACCACAGATGAACTCTGG + Intronic
945010414 2:205455745-205455767 ATGTAACCACTGGAGAAAATTGG - Intronic
945983019 2:216329669-216329691 ATGTAATTACTGATATAGTTAGG - Intronic
946216829 2:218190575-218190597 ATGTACACACTGATGTATTTAGG + Intergenic
946233415 2:218306888-218306910 ATGTAACCACTCTATAAGTTAGG - Intronic
946266408 2:218546143-218546165 TTGTAACCACTGGGGAAGATTGG - Intronic
946895048 2:224315266-224315288 ATGTAATTACTGTTGTAGTTGGG + Intergenic
947486884 2:230558676-230558698 ATGTAACTACTGATATATTTAGG - Intergenic
948712580 2:239834126-239834148 ATGCAACTCCTGATGAATTTTGG - Intergenic
1172924269 20:38516948-38516970 ATGTTAGCTCTGATTAAGTTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175345843 20:58274540-58274562 ATGTAATTATTGATGCAGTTAGG - Intergenic
1176875788 21:14125872-14125894 ATGTCACTACTGATATAGTTGGG - Intronic
1177386457 21:20415372-20415394 ATGATATCACTGATGAATTTTGG + Intergenic
1177937142 21:27363014-27363036 ATGTAAATACTGTTAAAGTTAGG - Intergenic
1178114487 21:29403822-29403844 ATGTACCCACTGATATGGTTTGG + Intronic
1178183701 21:30194435-30194457 ATGTAACCACTCAAGAAAATAGG - Intergenic
1182283320 22:29230555-29230577 CTGTCACTTCTGATGAAGTTCGG + Intronic
951189468 3:19751535-19751557 ATGTAACTACTGATGTAGCATGG + Intergenic
954302224 3:49706112-49706134 AGGTAACCACAGATGAAGTCTGG + Intronic
955488596 3:59460114-59460136 ATATAACCAATGATTAAGGTAGG - Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
962844069 3:139260202-139260224 ATGCAAGCACTGCTGAAATTGGG + Intronic
964155424 3:153579530-153579552 ATGTCACCAAAGATCAAGTTGGG + Intergenic
965166446 3:165198511-165198533 ATCAAACTACTGATGCAGTTTGG - Intergenic
965270188 3:166606020-166606042 AAGTTAACACTTATGAAGTTGGG - Intergenic
965877554 3:173345607-173345629 ATGTAATTACTGATGCTGTTAGG + Intergenic
968738608 4:2314395-2314417 ATGTAATCACTGATGTGGTTGGG + Intronic
969542072 4:7798492-7798514 ATTTCACCACTGATGAGGTCAGG + Intronic
971667083 4:29501640-29501662 ATATAACCACTGTTGAAATTTGG + Intergenic
972514497 4:39799377-39799399 ATGTGACCACTGGTGCAGATAGG - Intergenic
973756679 4:54081662-54081684 AGGAAACCACTGGTGAATTTGGG + Intronic
974057669 4:57000481-57000503 AAGTAACAACTGTTGAATTTGGG - Intronic
974353118 4:60774746-60774768 AAGGAAGCACTGAAGAAGTTAGG - Intergenic
974635470 4:64558811-64558833 ATGAAACCACTAATGTAGTGAGG - Intergenic
976050041 4:81000845-81000867 ATGTAACCTCTGTTGGAGTTTGG + Intergenic
979662461 4:123273309-123273331 ATGTTTACACTGATAAAGTTTGG - Intronic
980941384 4:139278743-139278765 ATATATACACTGATGAAGTAGGG - Intronic
981520584 4:145657833-145657855 ATATAAATGCTGATGAAGTTTGG + Exonic
991513576 5:67408213-67408235 AAAAAACCACTGATGCAGTTTGG - Intergenic
991520307 5:67489977-67489999 ATGTAATTACTGATACAGTTGGG - Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
992010666 5:72523843-72523865 ATGGAATCACTGATAAATTTGGG - Intergenic
993850912 5:93007731-93007753 ATTTAAGCACTCATGAATTTTGG + Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
995189474 5:109305222-109305244 CTGTAACCTCTGAAGAAGTCAGG - Intergenic
997876733 5:137555997-137556019 ATTTATCCAATGATGAAATTTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006692549 6:35901945-35901967 ATGTAACACCTGATAAACTTAGG - Intronic
1010520686 6:76831506-76831528 ATGAAAGCACTGAACAAGTTGGG - Intergenic
1011337497 6:86277208-86277230 TTGTAACCAGTAAAGAAGTTTGG + Intergenic
1012385772 6:98680506-98680528 ATCTAACTAATGATGTAGTTGGG - Intergenic
1012412680 6:98976809-98976831 CTGTCACCACTGCTGGAGTTTGG - Intergenic
1013984989 6:116180762-116180784 ATTTATTCACTGATGAAATTGGG - Intronic
1015818699 6:137237325-137237347 ATATCAACACTGATTAAGTTGGG - Intergenic
1020913002 7:14156888-14156910 ATGTACCAACTGATCAAATTTGG + Intronic
1021003396 7:15361671-15361693 ACATAACCACTAATGAAGTGTGG + Intronic
1021233677 7:18116908-18116930 ATGGAACCACTAATGAGCTTGGG + Intronic
1022272624 7:28824779-28824801 ATTTAACCACAGCTGAAGTGGGG + Exonic
1022301158 7:29103672-29103694 ATGTAACCAGTCCTGAAGATTGG - Intronic
1022448224 7:30487808-30487830 ATGTTACCACTGAGGAAAATTGG - Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028704871 7:93829980-93830002 ATGTTACCACTGAGGAAGACTGG + Intronic
1028783498 7:94765224-94765246 ATATAAACAATGATGAATTTGGG - Intergenic
1029938729 7:104457005-104457027 ATGGAAACTCTGATTAAGTTAGG + Intronic
1031764021 7:125752537-125752559 TTGTAACCACTGACAAAATTTGG + Intergenic
1033308198 7:140239973-140239995 ATGGAAACACTCCTGAAGTTGGG + Intergenic
1033680449 7:143589312-143589334 ATGTAACCACTGGTGAATCTAGG - Intergenic
1033704445 7:143872500-143872522 ATGTAACCACTGGTGAATCTAGG + Intronic
1033709316 7:143924427-143924449 ATGTTACCATTGATGAAAATTGG + Intergenic
1036580760 8:10073298-10073320 ATAAAAACACTGAGGAAGTTAGG - Intronic
1036912976 8:12774232-12774254 ATTTAACCACTGGGGAAGTTTGG - Intergenic
1037250584 8:16888788-16888810 ATGTAACCACTGTAGAAACTTGG - Intergenic
1037653471 8:20862206-20862228 TTGTTACCACTGTTGAAATTTGG + Intergenic
1038098775 8:24348022-24348044 ATGTAATTACTGATGTACTTGGG + Intronic
1040061027 8:43102836-43102858 AAGTAACCACTGATAATGTGTGG - Intronic
1041675142 8:60530706-60530728 TTGTAATCACTGATGGATTTGGG + Intronic
1042174899 8:66029154-66029176 ATGTCACAAATGATGAAGGTAGG - Intronic
1044020167 8:87096002-87096024 ATGTAACCTCAGAGGAAGTTAGG + Intronic
1045420242 8:102007414-102007436 ATGTATCAACTGATGAAATTCGG - Intronic
1045615412 8:103903910-103903932 ATATAACCACTGAGGAAACTCGG - Intronic
1045826531 8:106404314-106404336 AGGAAAACTCTGATGAAGTTGGG - Intronic
1046234889 8:111410358-111410380 AAGTAGCCACTGATCAGGTTTGG - Intergenic
1048190110 8:132280622-132280644 CTGTGACCACTGATAGAGTTTGG - Intronic
1050297879 9:4224647-4224669 ATGTAACAAAGGGTGAAGTTAGG - Intronic
1051058080 9:13011507-13011529 AAGAAACTACTGATGAAGTGAGG - Intergenic
1053039885 9:34861570-34861592 AGGCCACCACTGATCAAGTTGGG + Intergenic
1053677285 9:40446204-40446226 ATGTAACCACTGGGGAAACTAGG - Intergenic
1053927042 9:43072360-43072382 ATGTAACCACTGGGGAAACTAGG - Intergenic
1054286434 9:63178716-63178738 ATGTAACCACTGGGGAATCTAGG + Intergenic
1054290358 9:63281731-63281753 ATGTAACCACTGGGGAAACTAGG - Intergenic
1054388380 9:64586267-64586289 ATGTAACCACTGGGGAAACTAGG - Intergenic
1054507337 9:65930091-65930113 ATGTAACCACTGGGGAAACTAGG + Intergenic
1054799003 9:69328110-69328132 ATGAAACCATTGTTGAAGCTGGG - Intronic
1055312011 9:74992470-74992492 ATGTATCCACTGATAAATTTGGG - Intronic
1057234452 9:93347438-93347460 ACTTAAACACTGATGAATTTGGG - Intergenic
1058271859 9:102982710-102982732 TAGTAACCACTGATGATTTTTGG - Intergenic
1058371968 9:104279533-104279555 ATGTAACCTCTTATCAAATTAGG + Intergenic
1060772335 9:126341622-126341644 ATGTCAACAGTGCTGAAGTTGGG - Intronic
1060867528 9:127011956-127011978 AAGTAAACACTAATGAATTTCGG - Intronic
1185815592 X:3152190-3152212 ATGGAACCACTGATGGAATTTGG - Intergenic
1187276408 X:17819927-17819949 ATCTGACCACTTATGAATTTAGG + Intronic
1188774847 X:34202829-34202851 ATGTAACCTTTGATAAATTTTGG + Intergenic
1190969776 X:55337252-55337274 ATGTATCCACAGAAGTAGTTTGG - Intergenic
1191107587 X:56781158-56781180 ATGCAACCACAGATGAAGACAGG - Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1193266339 X:79474739-79474761 ATCTGCCCACTGATGAAGGTGGG - Intergenic
1196873549 X:120136122-120136144 ATGTGACCTCTGAAGAAATTTGG - Intergenic
1197446436 X:126555705-126555727 ATGGAACATCTGTTGAAGTTGGG + Intergenic
1198143351 X:133828552-133828574 ATGTAATTACTGATAAAGTAGGG - Intronic
1199293917 X:146135948-146135970 ATTTAACCACTGCTATAGTTTGG - Intergenic
1201265707 Y:12204558-12204580 ATGGAACCACTGATGAAATTTGG + Intergenic