ID: 1099105057

View in Genome Browser
Species Human (GRCh38)
Location 12:78486637-78486659
Sequence CTACACAGGCAGGTCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099105057_1099105061 -7 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105061 12:78486653-78486675 TGTGTAGCAAACTTGTGCCTGGG No data
1099105057_1099105066 29 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105066 12:78486689-78486711 CCACACATCTTCTGAAATCTAGG 0: 36
1: 723
2: 1913
3: 2020
4: 1592
1099105057_1099105062 1 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105062 12:78486661-78486683 AAACTTGTGCCTGGGTATCCTGG 0: 2
1: 49
2: 689
3: 1357
4: 1671
1099105057_1099105060 -8 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105060 12:78486652-78486674 CTGTGTAGCAAACTTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099105057 Original CRISPR CTACACAGGCAGGTCCCTCA TGG (reversed) Intergenic
No off target data available for this crispr