ID: 1099105061

View in Genome Browser
Species Human (GRCh38)
Location 12:78486653-78486675
Sequence TGTGTAGCAAACTTGTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099105051_1099105061 23 Left 1099105051 12:78486607-78486629 CCTTCTGCACACTGCCCTAGCAG No data
Right 1099105061 12:78486653-78486675 TGTGTAGCAAACTTGTGCCTGGG No data
1099105050_1099105061 24 Left 1099105050 12:78486606-78486628 CCCTTCTGCACACTGCCCTAGCA No data
Right 1099105061 12:78486653-78486675 TGTGTAGCAAACTTGTGCCTGGG No data
1099105057_1099105061 -7 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105061 12:78486653-78486675 TGTGTAGCAAACTTGTGCCTGGG No data
1099105053_1099105061 9 Left 1099105053 12:78486621-78486643 CCCTAGCAGAGGTTCTCCATGAG 0: 1306
1: 1881
2: 1574
3: 952
4: 721
Right 1099105061 12:78486653-78486675 TGTGTAGCAAACTTGTGCCTGGG No data
1099105054_1099105061 8 Left 1099105054 12:78486622-78486644 CCTAGCAGAGGTTCTCCATGAGG 0: 1076
1: 1793
2: 1653
3: 1123
4: 858
Right 1099105061 12:78486653-78486675 TGTGTAGCAAACTTGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099105061 Original CRISPR TGTGTAGCAAACTTGTGCCT GGG Intergenic
No off target data available for this crispr