ID: 1099105062

View in Genome Browser
Species Human (GRCh38)
Location 12:78486661-78486683
Sequence AAACTTGTGCCTGGGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3768
Summary {0: 2, 1: 49, 2: 689, 3: 1357, 4: 1671}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099105053_1099105062 17 Left 1099105053 12:78486621-78486643 CCCTAGCAGAGGTTCTCCATGAG 0: 1306
1: 1881
2: 1574
3: 952
4: 721
Right 1099105062 12:78486661-78486683 AAACTTGTGCCTGGGTATCCTGG 0: 2
1: 49
2: 689
3: 1357
4: 1671
1099105058_1099105062 -9 Left 1099105058 12:78486647-78486669 CCTGCCTGTGTAGCAAACTTGTG No data
Right 1099105062 12:78486661-78486683 AAACTTGTGCCTGGGTATCCTGG 0: 2
1: 49
2: 689
3: 1357
4: 1671
1099105054_1099105062 16 Left 1099105054 12:78486622-78486644 CCTAGCAGAGGTTCTCCATGAGG 0: 1076
1: 1793
2: 1653
3: 1123
4: 858
Right 1099105062 12:78486661-78486683 AAACTTGTGCCTGGGTATCCTGG 0: 2
1: 49
2: 689
3: 1357
4: 1671
1099105057_1099105062 1 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105062 12:78486661-78486683 AAACTTGTGCCTGGGTATCCTGG 0: 2
1: 49
2: 689
3: 1357
4: 1671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099105062 Original CRISPR AAACTTGTGCCTGGGTATCC TGG Intergenic
Too many off-targets to display for this crispr