ID: 1099105066

View in Genome Browser
Species Human (GRCh38)
Location 12:78486689-78486711
Sequence CCACACATCTTCTGAAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6284
Summary {0: 36, 1: 723, 2: 1913, 3: 2020, 4: 1592}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099105058_1099105066 19 Left 1099105058 12:78486647-78486669 CCTGCCTGTGTAGCAAACTTGTG No data
Right 1099105066 12:78486689-78486711 CCACACATCTTCTGAAATCTAGG 0: 36
1: 723
2: 1913
3: 2020
4: 1592
1099105063_1099105066 -4 Left 1099105063 12:78486670-78486692 CCTGGGTATCCTGGTGTTTCCAC No data
Right 1099105066 12:78486689-78486711 CCACACATCTTCTGAAATCTAGG 0: 36
1: 723
2: 1913
3: 2020
4: 1592
1099105057_1099105066 29 Left 1099105057 12:78486637-78486659 CCATGAGGGACCTGCCTGTGTAG No data
Right 1099105066 12:78486689-78486711 CCACACATCTTCTGAAATCTAGG 0: 36
1: 723
2: 1913
3: 2020
4: 1592
1099105059_1099105066 15 Left 1099105059 12:78486651-78486673 CCTGTGTAGCAAACTTGTGCCTG No data
Right 1099105066 12:78486689-78486711 CCACACATCTTCTGAAATCTAGG 0: 36
1: 723
2: 1913
3: 2020
4: 1592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099105066 Original CRISPR CCACACATCTTCTGAAATCT AGG Intergenic
Too many off-targets to display for this crispr