ID: 1099107809

View in Genome Browser
Species Human (GRCh38)
Location 12:78518769-78518791
Sequence GAGGGCAAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2287
Summary {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099107797_1099107809 23 Left 1099107797 12:78518723-78518745 CCTCCTCATCTCATTGGGACGGG No data
Right 1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG 0: 6
1: 75
2: 308
3: 635
4: 1263
1099107795_1099107809 24 Left 1099107795 12:78518722-78518744 CCCTCCTCATCTCATTGGGACGG No data
Right 1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG 0: 6
1: 75
2: 308
3: 635
4: 1263
1099107799_1099107809 20 Left 1099107799 12:78518726-78518748 CCTCATCTCATTGGGACGGGTTA No data
Right 1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG 0: 6
1: 75
2: 308
3: 635
4: 1263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099107809 Original CRISPR GAGGGCAAACAGAAGCAGGG TGG Intergenic
Too many off-targets to display for this crispr