ID: 1099109730

View in Genome Browser
Species Human (GRCh38)
Location 12:78543314-78543336
Sequence TTTGCTAAGCCCCAACATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099109730_1099109733 11 Left 1099109730 12:78543314-78543336 CCAAGATGTTGGGGCTTAGCAAA No data
Right 1099109733 12:78543348-78543370 AGTTGTCTTTAAAAGAGATAAGG No data
1099109730_1099109734 14 Left 1099109730 12:78543314-78543336 CCAAGATGTTGGGGCTTAGCAAA No data
Right 1099109734 12:78543351-78543373 TGTCTTTAAAAGAGATAAGGAGG No data
1099109730_1099109735 21 Left 1099109730 12:78543314-78543336 CCAAGATGTTGGGGCTTAGCAAA No data
Right 1099109735 12:78543358-78543380 AAAAGAGATAAGGAGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099109730 Original CRISPR TTTGCTAAGCCCCAACATCT TGG (reversed) Intergenic
No off target data available for this crispr