ID: 1099113041

View in Genome Browser
Species Human (GRCh38)
Location 12:78586838-78586860
Sequence GCTGCTTGTGCACACCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099113041_1099113046 -2 Left 1099113041 12:78586838-78586860 CCCACAAGGTGTGCACAAGCAGC No data
Right 1099113046 12:78586859-78586881 GCAATGTCAGTGGGAGAGATGGG No data
1099113041_1099113045 -3 Left 1099113041 12:78586838-78586860 CCCACAAGGTGTGCACAAGCAGC No data
Right 1099113045 12:78586858-78586880 AGCAATGTCAGTGGGAGAGATGG No data
1099113041_1099113048 17 Left 1099113041 12:78586838-78586860 CCCACAAGGTGTGCACAAGCAGC No data
Right 1099113048 12:78586878-78586900 TGGGTCTATCCATAGGATTCAGG No data
1099113041_1099113047 10 Left 1099113041 12:78586838-78586860 CCCACAAGGTGTGCACAAGCAGC No data
Right 1099113047 12:78586871-78586893 GGAGAGATGGGTCTATCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099113041 Original CRISPR GCTGCTTGTGCACACCTTGT GGG (reversed) Intergenic
No off target data available for this crispr