ID: 1099119622

View in Genome Browser
Species Human (GRCh38)
Location 12:78672153-78672175
Sequence GGCCTGGATTTCCCCAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099119618_1099119622 19 Left 1099119618 12:78672111-78672133 CCATAAGTACATTCTGTAATTTG No data
Right 1099119622 12:78672153-78672175 GGCCTGGATTTCCCCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099119622 Original CRISPR GGCCTGGATTTCCCCAGACC TGG Intergenic
No off target data available for this crispr