ID: 1099122295

View in Genome Browser
Species Human (GRCh38)
Location 12:78706377-78706399
Sequence GAACAGTGGCTGGCTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099122295_1099122302 8 Left 1099122295 12:78706377-78706399 CCTGTAACAGCCAGCCACTGTTC No data
Right 1099122302 12:78706408-78706430 GGGGATGCAGTAGTGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099122295 Original CRISPR GAACAGTGGCTGGCTGTTAC AGG (reversed) Intergenic
No off target data available for this crispr