ID: 1099127801

View in Genome Browser
Species Human (GRCh38)
Location 12:78787691-78787713
Sequence ATGTAGTTATTATTGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099127800_1099127801 3 Left 1099127800 12:78787665-78787687 CCTCTATTACTAGATCAAGAAGA No data
Right 1099127801 12:78787691-78787713 ATGTAGTTATTATTGCCCCATGG No data
1099127798_1099127801 16 Left 1099127798 12:78787652-78787674 CCCAGAGAGAAGGCCTCTATTAC No data
Right 1099127801 12:78787691-78787713 ATGTAGTTATTATTGCCCCATGG No data
1099127799_1099127801 15 Left 1099127799 12:78787653-78787675 CCAGAGAGAAGGCCTCTATTACT No data
Right 1099127801 12:78787691-78787713 ATGTAGTTATTATTGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099127801 Original CRISPR ATGTAGTTATTATTGCCCCA TGG Intergenic
No off target data available for this crispr