ID: 1099147173

View in Genome Browser
Species Human (GRCh38)
Location 12:79061149-79061171
Sequence AACTTCTAATCAGCGTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099147171_1099147173 4 Left 1099147171 12:79061122-79061144 CCATCAAGTTTTCTACTACTACC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1099147173 12:79061149-79061171 AACTTCTAATCAGCGTATTATGG 0: 1
1: 0
2: 0
3: 11
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099147173 Original CRISPR AACTTCTAATCAGCGTATTA TGG Intronic
905545043 1:38791029-38791051 AAGATCTAATCAGTGCATTAGGG - Intergenic
910391217 1:86746556-86746578 ACTTTCTAATGAGCGTAATATGG - Intronic
923183818 1:231550190-231550212 AACATATAATCAGCATATTTGGG + Intronic
1064635846 10:17366220-17366242 AACTTCTAATTAGAGTGTCATGG + Intronic
1066500745 10:35992041-35992063 AATTTCTAATTAGCGTATCATGG - Intergenic
1066628636 10:37436302-37436324 AAATTCTAATTAGCATATCATGG - Intergenic
1067190962 10:44067819-44067841 AACTTCTAGCCAGTGTAGTAAGG - Intergenic
1079212026 11:18470450-18470472 AAGTTCAAATCAGAGTTTTAAGG + Intronic
1079883719 11:25958919-25958941 AAGTTATAACCAGTGTATTAGGG - Intergenic
1081721415 11:45291681-45291703 AACTTCTAATCTGCGGTTCAAGG - Intergenic
1089641402 11:119849778-119849800 AACATCTTAACAGTGTATTAAGG + Intergenic
1094427380 12:30328926-30328948 AACATCTAATCATAGTGTTATGG - Intergenic
1095724006 12:45432505-45432527 AAATTATATTCAGTGTATTAAGG + Intronic
1097374864 12:58829941-58829963 AGGTTCTAATCAGTGTAATAAGG + Intergenic
1099147173 12:79061149-79061171 AACTTCTAATCAGCGTATTATGG + Intronic
1099753603 12:86810335-86810357 AAATTCTATTCAGTGTAATAAGG - Intronic
1100851008 12:98711070-98711092 AGCTCCTAATCAGCATATTGAGG - Intronic
1104609504 12:130216770-130216792 AACTGCTAATCAATGAATTAAGG + Intergenic
1108830224 13:54468545-54468567 AACGTTTAGTAAGCGTATTAGGG - Intergenic
1108941588 13:55962858-55962880 AACTTGTAGTCAGCTTATCATGG - Intergenic
1109425505 13:62161750-62161772 AATTTCTAATCAGCTTATTTTGG - Intergenic
1110175026 13:72546041-72546063 AACTTATAATCATGGTATAAGGG + Intergenic
1124710440 15:32005749-32005771 TACTTGTAATCAAAGTATTATGG + Intergenic
1125209080 15:37190752-37190774 AAATTCTAGTCAGTGTAATAAGG - Intergenic
1128741752 15:70088808-70088830 AAGTTCAAAGCAGCATATTACGG + Intronic
1134307735 16:13048304-13048326 AACTTCTGATCAGCATGATATGG + Intronic
1140596061 16:76414058-76414080 AACTTCTAGTTAGTGTAATAAGG - Intronic
1147199633 17:38791733-38791755 TACTTCTACTCAGTGTATTAAGG + Intronic
1150874098 17:68949259-68949281 AACTTGTTATCAGCCTATTCAGG - Intronic
1159166986 18:64715435-64715457 GACATCTAATCAGTGTATCAAGG + Intergenic
1162802135 19:13117214-13117236 AAGTTCTAACCAGTGTATGAAGG + Intronic
925372102 2:3353449-3353471 AACTTTTAATGAGTGTAATAAGG + Intronic
927386354 2:22538578-22538600 AATTTCTACTCAGAGTATAATGG - Intergenic
928457867 2:31439923-31439945 AAATTCTAATCAGTGTAATATGG - Intergenic
928468682 2:31550866-31550888 AAATTCTAGTCAGTGTAATAAGG + Intronic
929906097 2:46048057-46048079 TACTTCTAAACAGCGTGTCAAGG + Intronic
934872760 2:97882400-97882422 AACTTGAAATCAGCCTATTAGGG - Intronic
935670303 2:105550301-105550323 AAGTTCTAAGCAGTGTAGTAAGG + Intergenic
935765270 2:106360430-106360452 AACTTCTAAAAAGCTTATTATGG + Intergenic
936261021 2:110959600-110959622 AACTTCTAATCAGCCCAGCATGG - Intronic
937893655 2:126960517-126960539 GACTTCTAACCAGATTATTAAGG - Intergenic
941637134 2:167946639-167946661 AAATTCCAATCAGCTAATTAGGG - Intergenic
942482682 2:176405863-176405885 AACTTTAAATCAGAGTATCAGGG - Intergenic
943098190 2:183454722-183454744 AACTTCAACTCAGTGAATTAGGG - Intergenic
945959947 2:216122657-216122679 ATCTTCTTATCATCCTATTAAGG + Intronic
948452925 2:238088907-238088929 AAGTTCTGGTCAGCGTAGTAAGG + Intronic
1177324389 21:19565635-19565657 AATTTATAATCTGAGTATTAAGG + Intergenic
1182789706 22:32940965-32940987 AACATCTAATCAGTTTATTCAGG - Intronic
1182968104 22:34542885-34542907 AAATTCTAGTCAGTGTAATAAGG - Intergenic
1184587585 22:45458332-45458354 AACATGTAATCAGCGTCCTAGGG + Intergenic
951643210 3:24859073-24859095 AGCTTCTAATAAGAGTATTAAGG - Intergenic
951817088 3:26766203-26766225 AACTTCTTAACAGCATATTATGG - Intergenic
959107420 3:102080392-102080414 AACTTCTAATCAGCTTTTCAGGG + Intergenic
964947108 3:162239235-162239257 AAATTCGAATCAGCTAATTAAGG - Intergenic
965049067 3:163620749-163620771 AACTTCTAAGCAGATTATTAGGG - Intergenic
974089237 4:57293627-57293649 AACTTCTAGTCAGGGGCTTATGG - Intergenic
976140144 4:81983013-81983035 AACCTCTAATCAAAATATTAAGG - Intronic
977258545 4:94768640-94768662 AACTTCCAATCAGAGAATGATGG - Intronic
984478526 4:180268363-180268385 AAATTCTAATCAGTGCAGTAGGG + Intergenic
987877882 5:23703843-23703865 ATCTTCTAGTCAGCAGATTAAGG + Intergenic
989606867 5:43252741-43252763 AATTTCTAATCAGCCTAAAAGGG - Intronic
994695022 5:103063133-103063155 AGCCTCTATTCAGCATATTAAGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998829288 5:146139914-146139936 ACCTTCTAATTAGCATATTTAGG - Intronic
1002630216 5:180569178-180569200 AACTTCACATCAGAGTATTCAGG - Exonic
1003334925 6:5161769-5161791 AACTCCTGATCAGTGTAGTAGGG + Intronic
1008092166 6:47304961-47304983 AACTTCTAATCAGAGGAATGGGG - Intronic
1008844565 6:55947877-55947899 AAATACTAATAAGCATATTACGG + Intergenic
1009052641 6:58295750-58295772 AACTTGAGATCAGCTTATTATGG + Intergenic
1009238463 6:61154844-61154866 AACTTGAGATCAGCTTATTATGG - Intergenic
1010042397 6:71400952-71400974 AAGTTCAAATCAGAGTTTTAAGG + Intergenic
1011153802 6:84305867-84305889 TCCTTCTTATCAGCTTATTAGGG + Intergenic
1011469235 6:87691002-87691024 GACTTCTAATGAGTGTCTTATGG - Intronic
1012379897 6:98608228-98608250 AAATTCTAACCAGTGTAATAAGG + Intergenic
1014481724 6:121947325-121947347 CACTTCTATTCAACGTAGTATGG - Intergenic
1014623297 6:123696153-123696175 AAGTTCTAATCAGCTTATACTGG + Intergenic
1014678900 6:124403455-124403477 AACTCCTAACCAGCGAAGTAAGG - Intronic
1019170963 6:170132999-170133021 TGCTTCTCATCAGCGTATTTGGG + Intergenic
1024089909 7:45927787-45927809 AAGTCCTAATCAGTGTAATAGGG - Intergenic
1024126626 7:46304446-46304468 AATTTCTAATCTGCTAATTAGGG + Intergenic
1030261506 7:107569908-107569930 AACTTCTAGTCAGTGCAATAAGG - Intronic
1031185353 7:118472942-118472964 AACTTATATACAGCTTATTATGG - Intergenic
1031359359 7:120828747-120828769 AACTTCTAATGAGACAATTAGGG - Intronic
1033999475 7:147394229-147394251 AACTTATAATCAGGGTAGAAAGG - Intronic
1042256550 8:66810032-66810054 ACCTTCTAATGAGCGGAATATGG - Intronic
1047340639 8:123977170-123977192 AAGTTCTGATCAGCATATTGGGG - Intronic
1047609427 8:126506578-126506600 CACTTCTAATCAGCAGAGTATGG - Intergenic
1047681963 8:127263267-127263289 CACTTCTAATTAGTGTAATATGG - Intergenic
1056143054 9:83703005-83703027 AACTTCTAATTAGCTTATTCTGG - Intronic
1192545916 X:72013551-72013573 AAGTTCTAACCAGTGTAATAAGG - Intergenic
1192839691 X:74841506-74841528 CACTTCTATTCAGCATAGTAAGG - Intronic
1193034203 X:76931917-76931939 ATCTTTTAATCAGCGAAGTATGG - Intergenic
1193784522 X:85743454-85743476 CACTCCTATTCAACGTATTATGG + Intergenic
1194296858 X:92136747-92136769 AACTTTTAATCAGAGTGTGACGG + Intronic
1196421478 X:115526476-115526498 AAGTTCTACTCAGTGTAATAAGG - Intergenic
1196433025 X:115647652-115647674 AACTTCCATTCAGAGTTTTAAGG + Exonic
1198923256 X:141755234-141755256 AACTACTATTCTGCATATTATGG + Intergenic