ID: 1099147350

View in Genome Browser
Species Human (GRCh38)
Location 12:79063553-79063575
Sequence ATTTACACATAAGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099147343_1099147350 28 Left 1099147343 12:79063502-79063524 CCACTGTGCAGTCTGTCCCTATG 0: 1
1: 0
2: 2
3: 24
4: 266
Right 1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1099147345_1099147350 11 Left 1099147345 12:79063519-79063541 CCTATGTCTGCTTGTAAACCAAA 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1099147346_1099147350 -7 Left 1099147346 12:79063537-79063559 CCAAAGCATAATGTTCATTTACA 0: 1
1: 0
2: 1
3: 18
4: 257
Right 1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1099147344_1099147350 12 Left 1099147344 12:79063518-79063540 CCCTATGTCTGCTTGTAAACCAA 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099147350 Original CRISPR ATTTACACATAAGTGGAGGA GGG Intronic
901310687 1:8267361-8267383 ATTTTCACAGCAGTGGAAGAGGG + Intergenic
903201521 1:21743652-21743674 GGTTACACTTAAGGGGAGGAAGG + Intronic
903249642 1:22043451-22043473 ATGTGGGCATAAGTGGAGGAGGG + Intergenic
904250314 1:29218781-29218803 ATTTACACATAGCTGGAGGACGG + Intronic
905277825 1:36830363-36830385 ATTTGCACATAATTGGGGGTGGG - Intronic
907412894 1:54294913-54294935 ATTTTCAGGGAAGTGGAGGAAGG - Intronic
907980985 1:59480598-59480620 ATTTAAAAAGAAGAGGAGGAGGG + Intronic
909101250 1:71352190-71352212 ATTTAAAAAGAAGTAGAGGAGGG - Intergenic
909111402 1:71482890-71482912 ATTTACATTTTAGTTGAGGAGGG + Intronic
909774498 1:79467091-79467113 ATTTACCCACATGTGGAGGCAGG + Intergenic
911571991 1:99528502-99528524 ATTCACAAACAGGTGGAGGATGG - Intergenic
911803745 1:102178448-102178470 ATTTACAGATAAGCAGAGGGAGG - Intergenic
911937552 1:103998089-103998111 ATTTACAGAAATTTGGAGGATGG + Intergenic
912719590 1:112008487-112008509 CTTTACACATAAGTGGCTAATGG + Intergenic
913055808 1:115158655-115158677 TTTTACTATTAAGTGGAGGAAGG + Intergenic
914709463 1:150199792-150199814 TTTAAGACATCAGTGGAGGAAGG - Intergenic
914910750 1:151784142-151784164 ATTTAGGCACAGGTGGAGGAAGG - Intronic
916576500 1:166071688-166071710 TTTTACACACAAGGGGATGAAGG + Intronic
917590640 1:176472938-176472960 ATTGGCACATAAGTGGGGAAAGG - Intronic
918481000 1:184976534-184976556 ATTTACAAATGAGTGGATAAGGG - Intergenic
918845448 1:189603433-189603455 ATTTACACATAAGAAGAGAGAGG - Intergenic
921562417 1:216674763-216674785 ATTTACAAATTAGTTGAGCATGG - Intronic
1063538156 10:6905715-6905737 ATTTACGAATTAGTAGAGGAAGG - Intergenic
1069521149 10:69123055-69123077 ATTTAAAAATAAGTTGAGGCCGG - Intergenic
1069642001 10:69962171-69962193 GTTAACCCATAAGTGGAGGAGGG + Intronic
1070645619 10:78200188-78200210 ATTGACACATATTTGGAGTAAGG + Intergenic
1070709988 10:78674106-78674128 AGTTAAATATAAGTAGAGGAGGG + Intergenic
1070958902 10:80485390-80485412 ATTTACACAAAAATGCAGGAAGG - Intronic
1071169152 10:82843186-82843208 ATTTCCACATGAGTTGTGGAGGG - Intronic
1074926466 10:118077295-118077317 ATTTAAAATTAAGTGTAGGAAGG + Intergenic
1075972650 10:126667767-126667789 ATGTAGCCATAACTGGAGGATGG - Intronic
1077795742 11:5489684-5489706 ATTTAAAAAAAAGTGTAGGATGG + Exonic
1081856689 11:46308464-46308486 ATCTACACATTGGTGGAGGAGGG - Intronic
1082898602 11:58220640-58220662 TTTTTCAGATAAGTGGAGGTTGG + Intergenic
1083715262 11:64571678-64571700 ATTTACTCATCAGTGAGGGAGGG + Exonic
1085367797 11:75967820-75967842 ATTTTCTCATAAGTGTATGATGG - Intronic
1086221582 11:84451589-84451611 ATAAATAAATAAGTGGAGGAGGG - Intronic
1086677420 11:89625880-89625902 CCTTAGACATAAGTGTAGGAGGG - Intergenic
1087111368 11:94472779-94472801 ATTTGCACATATGTTGGGGATGG - Intronic
1087810949 11:102608638-102608660 ATTTACACATTGGGAGAGGATGG - Intronic
1090407323 11:126484760-126484782 ATATAGACCTAAGTGGAGGCGGG - Intronic
1092694434 12:11153670-11153692 ATTTAAACATAAGAGGAGGCAGG - Intronic
1093078854 12:14786784-14786806 ATTTCCAAAGAACTGGAGGAGGG + Exonic
1093665515 12:21808252-21808274 ATTTACATATAAGAGGATGCTGG + Intronic
1097790196 12:63807341-63807363 AACTACACATAATTGGAGAAAGG + Intronic
1098204260 12:68090764-68090786 ATTAACACATTATTGGAGGAAGG - Intergenic
1098812560 12:75114668-75114690 CTTTGCACATGTGTGGAGGAAGG - Intronic
1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG + Intronic
1102421904 12:112809899-112809921 ATTTACAGGTAAGAGGAGGCGGG - Intronic
1106964290 13:35040710-35040732 ATTTTCACATAAATGGAAAAGGG - Intronic
1107418579 13:40223923-40223945 ACTGCCACATCAGTGGAGGAAGG - Intergenic
1109551672 13:63910659-63910681 ATTTACATATAAGTATAAGAAGG - Intergenic
1111467740 13:88639234-88639256 ACTAAGACAAAAGTGGAGGAAGG + Intergenic
1111568275 13:90045478-90045500 ATTTTCAAAGAAGTGAAGGAAGG - Intergenic
1113090166 13:106609766-106609788 ATGTGCACATAAATGGGGGAAGG - Intergenic
1116242562 14:42364259-42364281 ATTTACACATAAGGGAACAATGG - Intergenic
1119913235 14:78370717-78370739 CTTTACATATAAGAAGAGGAAGG + Intronic
1120506940 14:85364549-85364571 ATTTTCAACTATGTGGAGGAGGG - Intergenic
1120639957 14:86998777-86998799 ATTTATTCATATGTGAAGGAGGG + Intergenic
1121656503 14:95600381-95600403 ATCTAGAAATAAGTTGAGGATGG + Intergenic
1122324084 14:100872320-100872342 AGTGACACCTAAGTGGTGGAAGG - Intergenic
1124517219 15:30376831-30376853 ATTGAGACAAAAGAGGAGGATGG + Intronic
1124725725 15:32154163-32154185 ATTGAGACAAAAGAGGAGGATGG - Intronic
1125091585 15:35799255-35799277 ATTTACTCAGAACTGGAGTATGG + Intergenic
1127599423 15:60520471-60520493 AATAACACATAAGAGGAAGAAGG + Intronic
1127699962 15:61489371-61489393 ATTAAAACAAAAGTGGAGGTGGG + Intergenic
1129864234 15:78891254-78891276 ATTTATAAATAAATGGAAGATGG + Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1134796713 16:17045621-17045643 AATAACACATAAGTGGCTGACGG - Intergenic
1136147469 16:28323727-28323749 ATTTACAAACACATGGAGGAAGG - Exonic
1138033775 16:53581785-53581807 ATGTACACATAAATGAAAGATGG - Intergenic
1139241379 16:65395745-65395767 TTTTACACATAAGAGGATTATGG - Intergenic
1141997340 16:87643980-87644002 ATTTACAAAGTAGTGGAGCATGG + Intronic
1149165757 17:53750072-53750094 ATTTACACAAAAGTGGACTAGGG - Intergenic
1149187060 17:54010860-54010882 CTTTACACATAAGTGAAGGAAGG - Intergenic
1149853686 17:60059082-60059104 CCTTACACATAGGTAGAGGATGG - Intronic
1151365594 17:73614266-73614288 CTTTACAGTTAAGTGCAGGAAGG + Intronic
1151448025 17:74179913-74179935 GTTTACTCATAAGTGGTTGATGG - Intergenic
1152180411 17:78817204-78817226 ATTTACACAGACGTAGATGACGG - Intronic
1152599281 17:81253442-81253464 ATTTACACCTAACTGGGGGCAGG + Intronic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1156028130 18:32680542-32680564 ATTTATACGTAATTGGTGGAAGG - Exonic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1158292676 18:55958867-55958889 ATTTAAACAGAAGTGGGGAAAGG + Intergenic
1158650506 18:59280314-59280336 ATTTACAGATATGAGGAAGATGG - Intronic
1159008507 18:63035883-63035905 CTTTCCAAATAAGTGGAGGTGGG + Intergenic
1159185344 18:64964774-64964796 AAATAAACATAAGTAGAGGAAGG + Intergenic
1159964014 18:74578761-74578783 GTTTACACATAGATGGAGTAGGG + Intronic
1162199270 19:9009143-9009165 ATTTACTCAGAGGAGGAGGAAGG - Intergenic
1163517338 19:17773013-17773035 ATTTACACATAAGATCAGGCTGG - Intronic
1164655439 19:29917787-29917809 CTTTACATATAACAGGAGGAAGG + Intergenic
1164793419 19:31006761-31006783 TTTTACACATAAGTGGGGTGGGG + Intergenic
1164856813 19:31531264-31531286 ATTTGCAGAGAAGTGGAGGGTGG - Intergenic
1167259145 19:48448457-48448479 ACTTACACACTAGTGGGGGAAGG + Intronic
1168483728 19:56742917-56742939 CTTTACCTGTAAGTGGAGGATGG + Intergenic
927502854 2:23593819-23593841 TTTTACACATAAGAGGTGGGAGG + Intronic
928111238 2:28510522-28510544 ATTTAAACAGAAGCTGAGGAGGG - Intronic
929306900 2:40373627-40373649 ATTTACACATAAGGAAATGAAGG + Intronic
930730295 2:54722938-54722960 ATTTACAGATAACCGGAGGTTGG - Intergenic
933446335 2:82384430-82384452 ATATACACATATGTGAGGGAGGG - Intergenic
937772170 2:125732331-125732353 ATTTATACCCAAGTGGTGGAAGG + Intergenic
937932226 2:127215802-127215824 ACTTACAAATCAGTAGAGGAAGG + Intronic
940611353 2:155996015-155996037 ATATACAGAAAAGTGTAGGAAGG - Intergenic
941094704 2:161224860-161224882 ATTCAAACATACGTGGATGAGGG - Intronic
941492260 2:166157162-166157184 ATTAACACAAAAATGTAGGAGGG - Intergenic
941605849 2:167595476-167595498 ACATACACACATGTGGAGGAAGG - Intergenic
942699471 2:178688182-178688204 AGTTACTCAGAAGAGGAGGAAGG - Exonic
942926552 2:181439966-181439988 ATTAACATATAGGTGGATGATGG - Intergenic
946684112 2:222249971-222249993 ATTTACTCATAAGTCAAGGTAGG - Intronic
1170051577 20:12151335-12151357 ATTTCAACATCAGTGTAGGAGGG + Intergenic
1170172713 20:13433318-13433340 TTTTAAACATAAGCAGAGGATGG - Intronic
1171287947 20:23957644-23957666 CTTTGCACAGAAGTGGAAGAAGG - Intergenic
1173559623 20:43993622-43993644 ATTTACACAAAACAGGTGGAGGG - Intronic
1176152099 20:63596719-63596741 ATTCACAGATAAGTGAAGGCCGG + Intronic
1178399167 21:32268982-32269004 TTTAACAAATAAGGGGAGGAAGG + Exonic
1179358662 21:40684990-40685012 ATTTACACTTAGGTGGAGCAAGG + Intronic
949496654 3:4638641-4638663 ATGTACACAGAAGTGGAGAAAGG + Intronic
949759529 3:7453922-7453944 ATTAACAAAAAGGTGGAGGAAGG + Intronic
951150690 3:19286599-19286621 ATTTAAACATCAGTGGATTATGG - Intronic
951211188 3:19976788-19976810 ATTTGCACATGAGTAGAAGAGGG - Intronic
951470523 3:23051506-23051528 ATTGACACATACTTGGAGGCAGG - Intergenic
951473695 3:23082394-23082416 TTTTACACAAAAGTGGAGCATGG + Intergenic
951795723 3:26536164-26536186 ATTTACAGATAAGTAAGGGAAGG + Intergenic
952160088 3:30684667-30684689 AATTACCCATAAGTCGAAGATGG + Intronic
955091416 3:55754946-55754968 AGTTAAACAAAAGTGGAGGTGGG + Intronic
955436203 3:58901435-58901457 ATTTACAGATAAGGAGAGCAGGG - Intronic
955614333 3:60790264-60790286 ATTTACAAATCAGTGAAGGAAGG + Intronic
956074892 3:65494455-65494477 GTTTACACATAAGTCAAGAAAGG + Intronic
957338577 3:78863386-78863408 TTTTACAACTAAGTGCAGGAAGG + Intronic
957748358 3:84375524-84375546 ATGTACACATAAGTGTGTGAGGG + Intergenic
958885698 3:99724384-99724406 ATTTATACACAAGAGAAGGACGG - Intronic
959286216 3:104414733-104414755 ATTTAAAAATAAGCAGAGGAGGG - Intergenic
960242505 3:115361879-115361901 ATTTCCACATGAGATGAGGATGG + Intergenic
960247411 3:115414712-115414734 ATGTTCACAGAAATGGAGGAAGG - Intergenic
960372477 3:116857956-116857978 AGTTTCATATAAGTGTAGGAAGG - Intronic
962696811 3:137957230-137957252 ATATACACAAAAGTAGAGAAGGG + Intergenic
965353749 3:167648145-167648167 ATTTACAAATAAGGAGATGAAGG - Intronic
966008570 3:175048356-175048378 ATTTTCAAAAAAGTTGAGGAAGG + Intronic
966010454 3:175068937-175068959 ATTAAAACATAAGTGGCGTATGG - Intronic
966529076 3:180953933-180953955 ATCTACACATAACTGGAATAAGG - Intronic
968738146 4:2310192-2310214 ATTTACAAATTAGTTGAGCATGG - Intronic
969388805 4:6875261-6875283 ATTTGCACAGAAATGTAGGAGGG + Intronic
972813748 4:42620674-42620696 TTTTACAGATAAGAGGAGGCAGG - Intronic
973641891 4:52911329-52911351 ATTTAGTCAAAAGTGGAGCAAGG - Intronic
973683601 4:53346681-53346703 ATTTACAGTCTAGTGGAGGAAGG + Intronic
974374919 4:61063671-61063693 ATCTACGGATAAGTGGAAGAAGG + Intergenic
974583753 4:63841894-63841916 ATTAAGAAACAAGTGGAGGATGG - Intergenic
975720108 4:77241013-77241035 ATTGCCACAGTAGTGGAGGACGG + Intronic
976621950 4:87137281-87137303 ATTTTCCTATTAGTGGAGGAGGG + Exonic
977517488 4:98039528-98039550 GTATACACAAAAGTGGAGGGTGG + Intronic
977521560 4:98090772-98090794 ATTTAGTGGTAAGTGGAGGAAGG - Intronic
977894199 4:102345502-102345524 CTTTACAAATAAGGGGAGGAGGG + Intronic
980421630 4:132567651-132567673 ATTAACACTGAAGTGGAGCAGGG - Intergenic
980671674 4:136017571-136017593 GATTATACATAAGAGGAGGAAGG + Intergenic
986920245 5:12671594-12671616 ATATACACAAGGGTGGAGGAGGG - Intergenic
986935737 5:12883760-12883782 TTTTCCACAGAAGAGGAGGAGGG - Intergenic
987192395 5:15491700-15491722 ATTTACAGATTTGTGGAAGAAGG - Intergenic
988141861 5:27253542-27253564 ATTTATTCACAACTGGAGGAAGG - Intergenic
989269292 5:39513126-39513148 AAATACAAATAAGTTGAGGAAGG + Intergenic
990703974 5:58506474-58506496 TTTTAAACATATGTGGAAGAAGG - Intergenic
990949500 5:61284289-61284311 AATTTCAGATATGTGGAGGAGGG + Intergenic
991111002 5:62899255-62899277 AATCACACATAAATAGAGGAAGG + Intergenic
992118993 5:73571637-73571659 ATTTAAAAATAAGTTGAGGCGGG + Intronic
996037579 5:118775502-118775524 AATTACACTTAATTGTAGGATGG + Intergenic
997428454 5:133820498-133820520 AAATATACATAAGTGGAGTAGGG - Intergenic
999690950 5:154145420-154145442 AGTCACGCATAAGTGGTGGAGGG - Intronic
1002948434 6:1784790-1784812 CTTTACACATAAGCAAAGGAAGG - Intronic
1003750711 6:9052163-9052185 ATTAACAAATAAAGGGAGGAGGG - Intergenic
1004634372 6:17452934-17452956 TTTTAAAAAAAAGTGGAGGAGGG + Intronic
1007267141 6:40605134-40605156 ATTTTCAGAGAAGTTGAGGAAGG - Intergenic
1008221342 6:48857273-48857295 ATCTAGACAAAAGAGGAGGAAGG - Intergenic
1008773422 6:55007384-55007406 ATTCACACATATGTGGGGCATGG - Intergenic
1008883348 6:56405032-56405054 ATTTACACATAGAGGGAGTAGGG + Intergenic
1010158478 6:72823138-72823160 ATTTACAATTAAGTGGGGGTTGG - Intronic
1011405944 6:87015660-87015682 AATGACACAGAGGTGGAGGATGG - Exonic
1012140633 6:95622921-95622943 ATTTGGAGATAAGTTGAGGAAGG - Intergenic
1013680249 6:112517380-112517402 ATTTGAACATAAATGGGGGAAGG + Intergenic
1014541548 6:122682189-122682211 AGTTACAGATAGGTGGAGGAAGG + Intronic
1014769841 6:125448139-125448161 ACTTATACTTTAGTGGAGGAGGG + Intergenic
1015088423 6:129325135-129325157 ATTTACACAAAAATGTGGGAGGG - Intronic
1016590614 6:145739488-145739510 ATTTACACTTAAATAGAGAATGG + Intergenic
1017912218 6:158803159-158803181 ATTGACACAGAAGTGGGGGCTGG + Intronic
1018488647 6:164269366-164269388 ATTTAAAGATAAGTAAAGGAGGG + Intergenic
1019914944 7:4126951-4126973 ATTTACACAAAAGAAGGGGAAGG - Intronic
1021240993 7:18201033-18201055 TTTTACACATAAGGGGAGCCAGG + Intronic
1021771887 7:24011319-24011341 ATTTAAACATTAGTGTTGGAGGG + Intergenic
1024979613 7:55146352-55146374 ATTTAGAAATATGGGGAGGAAGG - Intronic
1028926367 7:96360924-96360946 CTATACACATAAATGGAGCAGGG + Intergenic
1030091043 7:105858926-105858948 ATTCACACACATGTGGGGGAGGG + Intronic
1030520100 7:110588100-110588122 TTTTACAAATGAGAGGAGGAAGG - Intergenic
1031563285 7:123263940-123263962 ATTTAAACTTAAGTTTAGGAAGG + Intergenic
1032729668 7:134626993-134627015 ATGAACACACAAGTTGAGGAAGG - Intergenic
1035605997 8:929858-929880 ATGGACACATTAGTGCAGGATGG + Intergenic
1036778716 8:11631181-11631203 GTTTTCACATATGTGGAAGAAGG + Intergenic
1039196644 8:35039500-35039522 AGTTACAGATAAGTGAGGGAAGG + Intergenic
1039850162 8:41358034-41358056 ATAAAAATATAAGTGGAGGAGGG - Intergenic
1040652183 8:49461693-49461715 AGAAACACATAAGAGGAGGATGG + Intergenic
1042874671 8:73430119-73430141 ATTTTCAGAGAAATGGAGGAGGG - Intronic
1043240908 8:77934746-77934768 TTTTACAAATAAGTGAAGGGAGG + Intergenic
1046301143 8:112292537-112292559 CTTTGCACATAGGTGGAGGATGG + Exonic
1047660919 8:127035725-127035747 ATTTACACATACATGTAGGTAGG - Intergenic
1047822985 8:128541792-128541814 CTTTAAACATAAGTGAATGATGG - Intergenic
1048854922 8:138678430-138678452 ATTTACAGAAAATTTGAGGAGGG - Intronic
1049350655 8:142162777-142162799 ATTGACAGATGAATGGAGGAGGG + Intergenic
1050637369 9:7626525-7626547 TTTTACACATAAGTAGTTGAAGG - Intergenic
1050828767 9:9984642-9984664 ATTTACACTTAATGGGAGTAGGG + Intronic
1051682844 9:19625513-19625535 ATTTTCTCATAAGTAGATGATGG - Intronic
1052102231 9:24462550-24462572 ATTTACAATTTAGTGGAGCAAGG + Intergenic
1053191312 9:36072313-36072335 ATTTAGAGATAAGAGGAGCAGGG + Intronic
1054703932 9:68443847-68443869 ATTTCCACATAATAGGAGCAGGG - Intronic
1055027956 9:71742433-71742455 ATTTTCCCTCAAGTGGAGGAGGG - Intronic
1055529628 9:77171075-77171097 ATTAACAGATAAGTAGGGGAGGG + Intergenic
1057286613 9:93760843-93760865 ATTTAAATAAAAGTGGAGTAAGG - Intergenic
1058509157 9:105697195-105697217 GCTTACACAAAAGTGCAGGAAGG - Intronic
1059499571 9:114739436-114739458 ATTTACACATGAGTTGATTAAGG + Intergenic
1187469967 X:19560774-19560796 ATTTAGATATAAGAGGAGCAGGG + Intronic
1189076167 X:37917338-37917360 ATAAACACATAAATGAAGGAAGG - Intronic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190410014 X:50127535-50127557 ATTTAAACATAACATGAGGAAGG + Intergenic
1193750085 X:85330948-85330970 ATTTGCAGAGAATTGGAGGAAGG - Exonic
1196896334 X:120340478-120340500 ATTTATACATGAGGGGAGAAAGG - Intergenic
1197583389 X:128312443-128312465 ATTTATACATAAAAGGGGGAAGG + Intergenic
1199226126 X:145376861-145376883 ACCTACACTTAATTGGAGGATGG + Intergenic
1201009674 Y:9537952-9537974 ATTTACACATATGCAAAGGATGG - Intergenic
1201914120 Y:19164302-19164324 AAGTACACATAAGTGAAAGAAGG + Intergenic
1202266565 Y:23025635-23025657 ATTTAAACATCTATGGAGGAAGG + Intergenic
1202419558 Y:24659378-24659400 ATTTAAACATCTATGGAGGAAGG + Intergenic
1202451228 Y:25010706-25010728 ATTTAAACATCTATGGAGGAAGG - Intergenic