ID: 1099147979

View in Genome Browser
Species Human (GRCh38)
Location 12:79071793-79071815
Sequence GGCCTTAAGTCCAACATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099147979 Original CRISPR GGCCTTAAGTCCAACATAAC TGG (reversed) Intronic
913264069 1:117027351-117027373 GAAATCAAGTCCAACATAACAGG + Intronic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1075904033 10:126065088-126065110 GGCCATAAGTCCCACATAAGGGG + Intronic
1080087332 11:28299986-28300008 GGCCCTAAATCCAACATGACTGG - Intronic
1081461946 11:43280138-43280160 GGCCTTTAATCCAACATGACTGG - Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1083921105 11:65781637-65781659 GGCCCTAAGTCGAAAACAACGGG + Intergenic
1088278525 11:108114473-108114495 GGCCATAAATCCAATATGACTGG - Intergenic
1097393947 12:59050632-59050654 GGCCCTTAATCCAACATGACTGG - Intergenic
1097586239 12:61519670-61519692 GGCCCTTAATCCAACATGACTGG + Intergenic
1098010623 12:66046980-66047002 AGCCATAAGGCCAAAATAACTGG + Intergenic
1099147979 12:79071793-79071815 GGCCTTAAGTCCAACATAACTGG - Intronic
1101425937 12:104588647-104588669 GACCTTAGGTCAAACATCACCGG - Intronic
1101565353 12:105899708-105899730 GCCCTTAAGTCCAGCATACCTGG - Intergenic
1112374677 13:98828008-98828030 GGCCCTAAATTCAACATTACTGG + Intronic
1112582280 13:100686731-100686753 GGCCCTAAATCCAATATGACTGG - Intergenic
1113086910 13:106577986-106578008 GGCCCTTAATCCAACATGACAGG + Intergenic
1113475670 13:110579112-110579134 GGCCCTAAGTCCAATATGCCTGG + Intergenic
1122106803 14:99464038-99464060 GTCCTTATGTCCAATTTAACTGG - Intronic
1122615293 14:103013585-103013607 GGCCCTAAGTCCAACAAGACTGG + Intronic
1128255711 15:66195180-66195202 GGCCCTAAATCCAATATGACTGG - Intronic
1128408459 15:67368166-67368188 GGCCTTAAGTCCAGCTAACCTGG - Intronic
1128472960 15:67971538-67971560 GGCCCTAAATCCAATATGACTGG + Intergenic
1131552489 15:93369529-93369551 GGCCTTAAATCCAATGTGACTGG - Intergenic
1137690641 16:50424774-50424796 TGCCTTAAGTCTTACATAAGAGG - Intergenic
1138563771 16:57817644-57817666 GGCCTTAAGTCCAATATGACTGG - Intronic
1139694969 16:68667501-68667523 GTCCTGATGTCCAACATTACTGG - Intronic
1141671492 16:85494356-85494378 GGCCCCAAGTCCAACATGACTGG - Intergenic
1144138532 17:12322424-12322446 GGCCTTTAATCCAACGTGACTGG - Intergenic
1148946573 17:51267600-51267622 GACTTTAAGCCCAACTTAACAGG - Intronic
1149718191 17:58815263-58815285 AGTCTTAACTACAACATAACAGG + Intronic
1151235597 17:72717621-72717643 GGGCCTAAGTCCAACATGACTGG - Intronic
1152307257 17:79528615-79528637 GGCCCTACATCCAATATAACTGG + Intergenic
1153605797 18:6830095-6830117 GGCCCTTAATCCAACATAACTGG - Intronic
1158453950 18:57590581-57590603 GGCCTTTAATCCAAAATGACTGG - Intergenic
1158973345 18:62688482-62688504 GGCCCTAAATCCAATATGACTGG - Intergenic
1159548152 18:69866784-69866806 GCCTTTAAGTCCAAGATAACTGG + Intronic
1163952417 19:20602196-20602218 GGCCATATGTCCAACATGAAGGG + Intronic
1165066354 19:33231131-33231153 GGCCTTAGGTAGAACTTAACTGG - Intergenic
1166324119 19:42038645-42038667 GGCCTTAAGTCAGACACACCTGG + Intronic
1167529029 19:50003273-50003295 GGCCAGAAGTCCAAAATCACTGG - Intronic
925754606 2:7121455-7121477 GGGCTTAAAACCAACATGACGGG - Intergenic
926459644 2:13112734-13112756 GGCCCTTAATCCAATATAACTGG - Intergenic
929726091 2:44429043-44429065 AGCCTTAAGTTCAACATGACTGG - Intronic
931188926 2:59980657-59980679 GGCCCTAAGTACAATATGACTGG - Intergenic
932720869 2:74138336-74138358 AGCATTAAGTCCAACACAAATGG + Intronic
933871872 2:86574311-86574333 GGCCCTAAATCCAATATGACTGG + Intronic
937564962 2:123274294-123274316 TGCCTAAAGTCAAACATAAGAGG - Intergenic
947027230 2:225750073-225750095 GGCCTTTAATCCAATATGACTGG + Intergenic
1174894943 20:54438439-54438461 GGCCTTTAATCCAATATAAATGG - Intergenic
1179330014 21:40390766-40390788 GGCCCTTAATCCAACATGACTGG - Intronic
1179549327 21:42133770-42133792 GGCCCCTAGTCCAACATGACTGG - Intronic
1183047181 22:35229506-35229528 CCCCTTAAGTCTAACAGAACAGG + Intergenic
952101408 3:30017450-30017472 GGCCCTAAATCCAATATGACTGG + Intergenic
952943963 3:38463976-38463998 GGCCTCCAGTCCAACAGGACTGG - Intronic
953641482 3:44712242-44712264 GTCCTTTATTCTAACATAACAGG + Intergenic
956801094 3:72759115-72759137 GGCCTTTAATCCACCATAACTGG - Intronic
957900325 3:86481180-86481202 TGCCTTAACACCACCATAACTGG + Intergenic
962213006 3:133494827-133494849 GGCCTTTAATCCAATATGACAGG - Intergenic
963377981 3:144494459-144494481 GGCCCTAAATCCAACATGAATGG - Intergenic
964419573 3:156487145-156487167 ACCATTAAGTCCAATATAACTGG + Intronic
964624420 3:158745749-158745771 GGGCTGTAGTCCAACATGACTGG - Intronic
965751429 3:171978673-171978695 GGCCTTTAATCCAATATGACTGG - Intergenic
967907437 3:194513288-194513310 GGCCTGAAGTCCAACATTTAAGG + Intergenic
969725058 4:8913858-8913880 GGCCCTTAATCCAACATGACCGG + Intergenic
969971424 4:11052252-11052274 GGCCTTAAAGTCCACATAACTGG + Intergenic
970766239 4:19552102-19552124 GGCCCCTAGTCCAATATAACTGG + Intergenic
980908321 4:138971090-138971112 GGGCTTTAATCCAATATAACTGG + Intergenic
981020402 4:140021792-140021814 GGACTTAAGCCAAACAAAACTGG - Intronic
981358877 4:143824554-143824576 GGCCTCAAATCCAACAGGACTGG - Intergenic
981379398 4:144055379-144055401 GGCCTCAAATCCAACAGGACTGG - Intergenic
984885498 4:184445934-184445956 GGCCCTAAATCCAATATGACTGG + Intronic
985703942 5:1389937-1389959 GGCCCTAAATCCAATATGACAGG - Intergenic
986623429 5:9700836-9700858 GGTCTTAAATCTAACATGACCGG - Intronic
988961211 5:36373402-36373424 GGCCTCAAGTGCAAATTAACGGG + Intergenic
988961440 5:36375265-36375287 GGCCTCAAGTGCAAATTAACAGG + Intergenic
990009726 5:50982301-50982323 GGCCTTAAATCCAATGTGACTGG + Intergenic
990455632 5:55984416-55984438 GGCCTTTAGTACAATATGACTGG + Intronic
990909582 5:60840293-60840315 GGCCCTAAATCCAATATGACTGG + Intronic
998010100 5:138688114-138688136 GGCCCTAAATCCAATATGACTGG + Intronic
1000346460 5:160318336-160318358 GGCCCTTAGTCCAATATGACCGG - Intronic
1000435488 5:161202661-161202683 GGCCTTAATTTCAGAATAACAGG - Intergenic
1004332256 6:14732626-14732648 GGCCCTTAATCCAATATAACTGG - Intergenic
1007296519 6:40826330-40826352 GGCCTTTAATCCAATATGACTGG + Intergenic
1008791929 6:55245962-55245984 GGCCTTTAATCCAATATGACTGG + Intronic
1009484118 6:64198413-64198435 GGACTTAAGACCTACATGACAGG - Intronic
1009545785 6:65018462-65018484 GGCCCTTAATCCAATATAACTGG - Intronic
1011507390 6:88061370-88061392 GGCCTTTAATCCAATATAACTGG + Intronic
1012686378 6:102255802-102255824 GGGCTTAAATCCTACATGACTGG - Intergenic
1017046120 6:150348640-150348662 GGCCCCAAATCCAACATGACTGG - Intergenic
1017997293 6:159543156-159543178 GGCCTTACCTCCAACATTGCAGG - Intergenic
1020123050 7:5516338-5516360 GCCCTTAAATCCAACATGACTGG - Intergenic
1021919250 7:25467188-25467210 GGTCTTAAGTCCAACTGAACTGG + Intergenic
1022036463 7:26539125-26539147 GGCATTAAGTCCAATTTAAAAGG - Intergenic
1028897646 7:96060318-96060340 GGCCTGAAGTCCGACATACATGG + Intronic
1030186631 7:106768825-106768847 GGCCCTAAATTCAATATAACTGG - Intergenic
1034362907 7:150516719-150516741 GGTCTTTTGTCCAACAGAACTGG + Intronic
1034555772 7:151849576-151849598 GGCCTGAAGTCCAAGATCAAGGG + Intronic
1036721254 8:11177584-11177606 GGCCCTTAATCCAACATGACCGG + Intronic
1045245314 8:100437248-100437270 GGCCCTAAATCCAATATGACTGG + Intergenic
1045468442 8:102489939-102489961 GGCCCTACGTCCAAAATGACTGG + Intergenic
1047685214 8:127298389-127298411 GGCCTTGAGCCCAACAGAAACGG - Intergenic
1050092669 9:2030823-2030845 GACCTAAAGTCCTACGTAACTGG - Intronic
1051572420 9:18574774-18574796 TGGCTTAAGTCCAACCTAGCTGG - Intronic
1052474100 9:28936864-28936886 GGCTGTAAGTCCAACATCAAGGG + Intergenic
1056389561 9:86128318-86128340 GGAGTTCAGTCCAAAATAACGGG - Intergenic
1056799308 9:89680463-89680485 GTCCTTGAGTCCAACCTACCAGG - Intergenic
1058183237 9:101823244-101823266 GGGCTTAAGGCCAACCTAAAGGG + Intergenic
1186023452 X:5283021-5283043 GGCCAGAAGTCCAAAATAAAAGG + Intergenic
1187748829 X:22438840-22438862 GGCCCTTAATCCAACATGACTGG + Intergenic
1187928349 X:24271171-24271193 GGCATTAAATCCAATATGACTGG - Intergenic
1193645324 X:84061179-84061201 GGCCTTAGGGCCAAGATAAATGG + Intronic
1194115767 X:89895378-89895400 TGCCTCAGGTCCCACATAACTGG + Intergenic
1197440871 X:126488070-126488092 GGCCCTAAATCCAACAGCACTGG + Intergenic
1200468564 Y:3552505-3552527 TGCCTCAGGTCCCACATAACTGG + Intergenic