ID: 1099148690

View in Genome Browser
Species Human (GRCh38)
Location 12:79080857-79080879
Sequence TTAAGATGACAGATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099148687_1099148690 4 Left 1099148687 12:79080830-79080852 CCACTTTCAATACTTCGTCAAAA 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG 0: 1
1: 0
2: 2
3: 16
4: 224
1099148686_1099148690 8 Left 1099148686 12:79080826-79080848 CCTTCCACTTTCAATACTTCGTC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG 0: 1
1: 0
2: 2
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099148690 Original CRISPR TTAAGATGACAGATGGGACA AGG Intronic
902481700 1:16715504-16715526 GTTAGATGACAGCTGGGACCAGG + Intergenic
903959983 1:27050886-27050908 TCAAGATGTCAGCTGGGACTGGG + Intergenic
905279251 1:36838425-36838447 TTTAGATGAGAGATGGGGGATGG + Intronic
905314377 1:37072302-37072324 GTGAGATGACACATGGGAGAGGG - Intergenic
905366691 1:37455433-37455455 TAAAGGTGACACGTGGGACATGG - Intergenic
909926423 1:81442801-81442823 TTAAAATGGTAGATGGGAAATGG - Intronic
911330799 1:96523614-96523636 TTAAGAGGAGAGAGGGGAGAGGG - Intergenic
913235696 1:116781071-116781093 TTAATAAGATAGATGTGACAAGG + Intergenic
913503365 1:119492388-119492410 TCAAGAAGAAATATGGGACAAGG + Intergenic
915137583 1:153744200-153744222 TAAAGATCCCAGATGGAACATGG + Intronic
917083652 1:171283400-171283422 TTAAGAAGAGAGAAGGGAAAGGG + Intronic
917453645 1:175167634-175167656 GTGAGAGGACAGATGGGAGAGGG + Intronic
922327808 1:224545312-224545334 TTAAGATGAGAGAAGAGACAAGG - Intronic
923042677 1:230330974-230330996 TTAAGATGACAAATGTTAAAAGG - Intronic
923747753 1:236718471-236718493 TTATGAAGACAGATGGATCAGGG - Intronic
924425790 1:243949007-243949029 TTAAAATGACTGATAGGATATGG + Intergenic
924955969 1:248927204-248927226 TTGTCATGAGAGATGGGACAGGG + Intergenic
1063983842 10:11479887-11479909 TTAAAAGGACAGATGTGACATGG + Intronic
1068162216 10:53279116-53279138 TTAAGATGTCAGATTGGGCCAGG - Intergenic
1071188718 10:83076251-83076273 ATTACATAACAGATGGGACATGG + Intergenic
1072749321 10:97965930-97965952 AGGAGATGACAGATGGGGCAGGG + Intronic
1072769642 10:98126763-98126785 TTAAGATGGCAGATAGGAGGCGG - Intergenic
1074961441 10:118449434-118449456 TTAAGATGAAAGGTGTGAAATGG + Intergenic
1075067468 10:119299040-119299062 TGAAGATGAAAGAGGAGACAGGG - Intronic
1080733046 11:34980475-34980497 TAAAGAAGACTTATGGGACACGG - Intronic
1081346556 11:41994528-41994550 TAGAGATGACAGCTGAGACATGG + Intergenic
1083821200 11:65172366-65172388 TGGAGGTGTCAGATGGGACAGGG + Intronic
1086079395 11:82887790-82887812 TTAAGATCAACTATGGGACAAGG - Intronic
1086118100 11:83275953-83275975 TTATTATTACCGATGGGACAGGG + Intronic
1086297984 11:85392790-85392812 GTAAGGTGAGAGATGAGACAAGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088654885 11:111989751-111989773 ACTAGATGACTGATGGGACAGGG - Intronic
1088849525 11:113693581-113693603 GTAAGTTGAGAGATGGGACCAGG - Intronic
1088981672 11:114870178-114870200 TTAAGGGGACAGATGGTGCAGGG + Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1091763996 12:3106472-3106494 TTAAAAAGAAAGATGGGACTGGG + Intronic
1092015184 12:5152721-5152743 TGTAGGTGACAGATCGGACAGGG - Intergenic
1092361642 12:7841554-7841576 TTAACATGACAGATGTGGCTCGG - Intronic
1093216716 12:16370266-16370288 TTAGGAAGACAGATGGGACAAGG + Intronic
1094440213 12:30467132-30467154 GTAAAATGAAAGATGGGAAAAGG + Intergenic
1094461335 12:30699420-30699442 TGAAGATGATAGATTGGAGAAGG + Intergenic
1094638931 12:32254345-32254367 TGAATATGACAGGTGGGATACGG - Intronic
1095357584 12:41293756-41293778 TTAAGAGGACAAATGGGATCAGG - Intronic
1096274344 12:50192838-50192860 TAAAAATGACAAATGGCACAAGG - Intronic
1096782905 12:54001076-54001098 TTATGATTTGAGATGGGACAGGG + Intronic
1098124477 12:67276031-67276053 TAAAGAAGACAGACGGGAGAAGG - Intronic
1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG + Intronic
1100096418 12:91043551-91043573 TTCAGGTGACAGATGGCAGAAGG - Intergenic
1101392333 12:104313187-104313209 TTAACATGACAGATTGGAAATGG - Intronic
1101440704 12:104702534-104702556 TGATGTTGACTGATGGGACATGG + Intronic
1102826739 12:115953147-115953169 TTATGCTGACAGACTGGACATGG + Intergenic
1104167166 12:126243606-126243628 TGCAGATGAAAGATGGGAAAAGG - Intergenic
1105480255 13:20768844-20768866 TAAAGGTGACAGAGAGGACATGG + Intronic
1106920789 13:34561229-34561251 CTAACATGACAGATTGGACGTGG + Intergenic
1108935387 13:55875349-55875371 TGAAGATGGAAGATGGGAAATGG - Intergenic
1109024480 13:57141231-57141253 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109025467 13:57147801-57147823 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109026457 13:57154374-57154396 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109027449 13:57160945-57160967 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109028435 13:57167510-57167532 TTAGGAAGACAGAGGTGACAAGG - Intronic
1109406575 13:61908127-61908149 TTAATATTACAGATAGCACATGG + Intergenic
1110247681 13:73344728-73344750 TTAACATGAGAAATGGAACAGGG - Intergenic
1111663656 13:91241726-91241748 TTCACAGGACAGATGGGAAATGG + Intergenic
1112872742 13:103994857-103994879 TGAAGAGGAGAGAGGGGACAAGG - Intergenic
1113824815 13:113243667-113243689 TGAAGATGTAAGATGGAACATGG + Intronic
1114424737 14:22612143-22612165 AAAAGCTGACAGATGGGTCAGGG - Exonic
1116105105 14:40492650-40492672 TTAAAATAACAGATGGTAAAAGG - Intergenic
1118105878 14:62658851-62658873 AAAAGTTGACAGATGGGACTTGG + Intergenic
1118412584 14:65497226-65497248 CTAAGATGAAAGATGGGAATGGG + Intronic
1119167308 14:72505376-72505398 TTCACATGACAGAAGGGAAAGGG + Intronic
1119987918 14:79160770-79160792 AGAAGCTGACAGATGGCACATGG + Intronic
1122420147 14:101571363-101571385 TTAGGATGGCAGTGGGGACAGGG - Intergenic
1125985724 15:44049655-44049677 TGGAGATGACAGAAAGGACAAGG - Intronic
1127204559 15:56700604-56700626 TTAAGATTGCAGACGGGACCAGG - Intronic
1128666924 15:69545134-69545156 TGAGGATGACACATGTGACAAGG - Intergenic
1131018352 15:89076289-89076311 TTGAGATGAAAGATTGGCCATGG - Intergenic
1131636208 15:94235481-94235503 TTAAGAGAACAGATAGGGCATGG + Intronic
1132635848 16:946140-946162 TGCAAATGACACATGGGACATGG + Intronic
1133093022 16:3419773-3419795 TTAAAGTGAGAGATGGGCCAAGG + Intronic
1133782566 16:8951356-8951378 TTAAGATGACAGCTTTCACAAGG - Intronic
1135141562 16:19926511-19926533 TTAAGAATACAGATGGGGCCGGG - Intergenic
1136632732 16:31498482-31498504 TTAAGTTGACACATGGGCCTTGG + Intronic
1137557688 16:49483056-49483078 TTAAGAAGACAGTAGGGCCAGGG + Intergenic
1139045200 16:63049299-63049321 TGGAGGGGACAGATGGGACAGGG + Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1140878252 16:79173292-79173314 CTAAGATGGCACATGGCACATGG - Intronic
1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG + Intergenic
1144132282 17:12258157-12258179 TTTGGAGGACAGATGGGCCACGG + Intergenic
1144877189 17:18404773-18404795 CTGAGATGACAGATGGGAAGGGG + Intergenic
1145155041 17:20539633-20539655 CTGAGATGACAGATGGGAAGGGG - Intergenic
1149735133 17:58986803-58986825 TTAAGATGACAGATGGGGCTGGG - Intronic
1153905696 18:9659481-9659503 TTAAAAGGACAGATGGCACTGGG + Intergenic
1155477875 18:26253120-26253142 CTAAGATGAAGGATGAGACAAGG - Intronic
1157188157 18:45558199-45558221 TTTAGAGGACAGATGGGATTTGG - Intronic
1158214717 18:55087994-55088016 TTAAGATGAGAGATAGTAAAAGG + Intergenic
1158463137 18:57664655-57664677 TTAAAATGATATATGTGACAAGG + Intronic
1160353199 18:78202825-78202847 TTAAGATTACAGATGAAACATGG + Intergenic
1161674303 19:5635473-5635495 TTAAGAGGACAGTAGGGAAAAGG + Intronic
1162838916 19:13341292-13341314 TCAAGATGTCAGCTGGGCCATGG - Intronic
1163132081 19:15280628-15280650 GTAAGATGCCTGAGGGGACATGG + Intronic
1163244694 19:16086161-16086183 TTTAGATGAGAGATGGGACTAGG + Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
1202715739 1_KI270714v1_random:41416-41438 GTTAGATGACAGCTGGGACCAGG + Intergenic
925047200 2:781733-781755 TTGAAATGAAAGATGGGAGAGGG - Intergenic
925252991 2:2457276-2457298 TTGAGATGAGAGATGGGAGAAGG + Intergenic
925652391 2:6104788-6104810 TTAAGATGGCAGATGGGAGTCGG - Intergenic
929124522 2:38511091-38511113 AAAAGCTGACACATGGGACATGG + Intergenic
929781889 2:44962444-44962466 GTGAGAAGACAGATGGGATAGGG - Intergenic
933292641 2:80454757-80454779 TTGAGCTGACATATGGCACAGGG + Intronic
934489582 2:94751885-94751907 TTAAGGTGGCAGAGGGGAAAGGG - Intergenic
934715247 2:96539276-96539298 CCAAGAGGACAGATGGGGCAAGG - Intronic
936986083 2:118312198-118312220 TTCACATGACAGATGGGATCAGG - Intergenic
938969514 2:136419323-136419345 CTAAGATGAAAGATGGGTGATGG + Intergenic
941497820 2:166228823-166228845 TTAACACCACAGATGGGTCACGG - Exonic
941595757 2:167475209-167475231 TTCAGGTACCAGATGGGACAGGG - Intergenic
941746194 2:169089205-169089227 TTCAGAGGACTGAAGGGACAAGG + Intronic
941788867 2:169528753-169528775 GAAAGATGACAAATGGGAAATGG - Intergenic
942800259 2:179866945-179866967 TAAAAATGAGAGATGGGAAAAGG - Intergenic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
943579179 2:189663802-189663824 TTAAAATTAGAGATGGGATAAGG - Intronic
945845977 2:214944939-214944961 TTAGGATGACAGGTGGGAAAAGG - Intronic
948179060 2:235965883-235965905 TGAGGATGAAAGATGGGACCAGG + Intronic
948926755 2:241103820-241103842 ATAAAATGACAGCTGGGACATGG + Intergenic
1170086661 20:12540766-12540788 TTAAGATCAGAAATGAGACATGG - Intergenic
1170418136 20:16166222-16166244 TTGAGATGACAAATGTGAAAAGG - Intergenic
1174219363 20:48940770-48940792 TCAAGATGGCAGAGGGGTCAGGG + Intronic
1174416552 20:50371245-50371267 TTTAAATGACAGATGGGGCCAGG + Intergenic
1176980008 21:15370865-15370887 TGGAGATGACAGACGGGAGAGGG + Intergenic
1182762520 22:32734299-32734321 TTAAGATGATAGAGCGGATAAGG - Intronic
1183290848 22:37000896-37000918 TTAAGATGACAGAGTGGAAGGGG + Intronic
950723294 3:14899773-14899795 TTAAGGAGACAGAGGGAACAGGG + Intronic
952261815 3:31747429-31747451 TTAAAATGACAAAATGGACACGG - Intronic
955012016 3:55026711-55026733 GAGAGATGACAGAGGGGACAAGG + Intronic
956017563 3:64899945-64899967 TTAAGGAGACAGATGGTAGAAGG + Intergenic
956051694 3:65255227-65255249 TCAAGATGACATTTGGGATATGG - Intergenic
956102751 3:65785913-65785935 TTAAGATGACAGCAGGAATAAGG - Intronic
956802261 3:72770450-72770472 TTAAGATGACAGAATGATCAGGG + Intronic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
959115618 3:102174463-102174485 TTAAGCTGACAGAAGGCAGAAGG + Intronic
959125985 3:102290850-102290872 TTAAGATGATGGATGGGAAGCGG - Intronic
962508631 3:136075842-136075864 TTAACTTGAGAGAGGGGACATGG + Intronic
962762690 3:138530591-138530613 GGAAGAAGACAGGTGGGACATGG - Intronic
964220050 3:154333006-154333028 ATCAGCTGACAGATGGGAAAAGG - Intergenic
965268024 3:166572642-166572664 TTAAGGTGATAGATGGTAGATGG + Intergenic
972563473 4:40248963-40248985 ATGACATGACAGAGGGGACAGGG + Intergenic
974411907 4:61552757-61552779 TTAAAAAGGCTGATGGGACACGG - Intronic
975426002 4:74228547-74228569 TTATTATGACAAATGGCACATGG + Intronic
975464259 4:74691857-74691879 TTAAGAGGACAGAGAGGGCAAGG - Intergenic
976963262 4:91004255-91004277 TTAAGATGAGACTTGGGAAAAGG - Intronic
976980533 4:91220343-91220365 ATGACCTGACAGATGGGACAAGG + Intronic
977644955 4:99401986-99402008 CTAAGATGTGAGATGGGACTAGG + Intergenic
982739719 4:159044741-159044763 TCAAGGTGACGAATGGGACAAGG + Intergenic
983011371 4:162551250-162551272 TTCAGGTGACAGAAGGGAAATGG - Intergenic
983217647 4:165017021-165017043 TAGTGAGGACAGATGGGACAGGG - Intergenic
987544177 5:19290886-19290908 TTCACATGACAGAAAGGACAAGG + Intergenic
992137705 5:73764068-73764090 TGAAAATAACAAATGGGACAGGG - Intronic
993920579 5:93795579-93795601 TTAAGATGGCAGATGGGGGCAGG - Intronic
994871307 5:105352478-105352500 TTAAGCTCAAAGATGGGTCAAGG + Intergenic
995456105 5:112353831-112353853 CTAGGACAACAGATGGGACAAGG + Intronic
997274426 5:132572881-132572903 TTAACATTACAGATGGAACTGGG - Intronic
997274913 5:132577377-132577399 TTAAGATTACAGATGGAATTAGG - Intronic
997310422 5:132875187-132875209 TTAAGATTTCTGTTGGGACAAGG + Intergenic
997628997 5:135352300-135352322 TCAAGATGGCAGATGGTTCAGGG - Intronic
998262346 5:140641092-140641114 TGAAGAAGACAGATGTCACAAGG + Intronic
998929424 5:147164122-147164144 TTAAGAAGAAAGATGGAAGAGGG - Intergenic
1002997848 6:2303844-2303866 TGAAGAAGACAGATGGGTCTTGG + Intergenic
1003378149 6:5598094-5598116 TTTAGGTGAAAGATGGGGCAAGG + Intronic
1003798409 6:9632006-9632028 TTAAAATTACAGATGGAAAAGGG + Intronic
1004260104 6:14100622-14100644 CAAGTATGACAGATGGGACAAGG + Intergenic
1004854045 6:19731323-19731345 TCCAGATGACAGTTGGGCCAGGG - Intergenic
1008729981 6:54469924-54469946 TCAAGATGTCTGTTGGGACAGGG + Intergenic
1009555519 6:65159959-65159981 TCAAGGTGATTGATGGGACATGG + Intronic
1010276837 6:73978170-73978192 TTAAAATGATAGATGCCACAAGG - Intergenic
1010536687 6:77039274-77039296 TTGAGGTGACACATGGGAAATGG - Intergenic
1012525356 6:100170554-100170576 TAAAGAAGACAGATAGCACAAGG - Intergenic
1014199230 6:118590242-118590264 TTAAAAAAACAGATAGGACAAGG + Intronic
1014329642 6:120046303-120046325 TTAAGATAATAGATGCAACAGGG + Intergenic
1015083793 6:129263034-129263056 TTCACTTGACAGATGAGACAGGG + Intronic
1016861393 6:148722014-148722036 GGAAGAAGACAGATGGGAGAGGG - Intergenic
1017354054 6:153481413-153481435 TTTAGGTGATGGATGGGACATGG - Intergenic
1020922908 7:14287275-14287297 TTAAAAGGACAGATGGTAGAGGG - Intronic
1021552452 7:21885851-21885873 CTAAGATGAGAAATGGGAAAAGG - Intronic
1021871566 7:25012001-25012023 TAAAGATGACAGAAGGGCCTTGG + Intergenic
1022712746 7:32866972-32866994 TTAAGATGACAGATCTGAGCTGG + Intergenic
1023642211 7:42271010-42271032 TTAATATGAAAGAAGGGAGAGGG + Intergenic
1024370785 7:48581386-48581408 TTAAGACGGGAGATGGGAAAAGG - Intronic
1024636183 7:51292263-51292285 TTAAAATGACAAAATGGACATGG - Intronic
1026573603 7:71553878-71553900 TTAAGAGGAAAGCTGGGAGAGGG - Intronic
1027704638 7:81513719-81513741 TTAACTTGAGAGATGAGACAGGG - Intergenic
1030662364 7:112234403-112234425 TTTACATGGCAGAAGGGACAAGG + Intronic
1031693069 7:124814782-124814804 TTAAGATCACAAAAGAGACATGG - Intergenic
1032545301 7:132737102-132737124 TTAAGATCACAGATGGCAGCAGG - Intergenic
1034399400 7:150852167-150852189 TGAAGCTGACAGATGGACCAGGG - Intronic
1036107338 8:5855165-5855187 TTAATAGGACAGATGGCCCAGGG - Intergenic
1037228589 8:16626001-16626023 TTAGGATACCAGGTGGGACATGG + Intergenic
1037869865 8:22483579-22483601 ATAAAATGACATATGGGACTGGG - Intronic
1037995432 8:23348934-23348956 TCAAGCTGGCAGTTGGGACATGG - Intronic
1038298249 8:26316738-26316760 TTGACATGATAGAAGGGACAAGG + Intronic
1038525216 8:28267402-28267424 TTCAGATCTAAGATGGGACAAGG + Intergenic
1039955708 8:42205818-42205840 TTAAGAACACACATGTGACACGG - Intronic
1040308862 8:46226316-46226338 TGAAGCTGGCAGATGGGAGAAGG + Intergenic
1040730443 8:50440759-50440781 TTAAGATGACAGAAGGAAGATGG + Intronic
1040897568 8:52384715-52384737 TTAGAATGACACATGGGAAAAGG - Intronic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1046372527 8:113328141-113328163 ATAAGATGAAAGATGGGGCCGGG + Intronic
1048264699 8:132975211-132975233 GTAAGAGGACAGATGGGGCAAGG - Intronic
1051856175 9:21568010-21568032 CAAAGATGACACATGGCACATGG + Intergenic
1053684368 9:40507511-40507533 CTGAGATGACTGAGGGGACAGGG + Intergenic
1053934337 9:43135797-43135819 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054279357 9:63117442-63117464 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054297462 9:63342975-63342997 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054395480 9:64647483-64647505 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054430126 9:65152683-65152705 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054500257 9:65868849-65868871 CTGAGATGACTGAGGGGACAGGG - Intergenic
1055758314 9:79579024-79579046 TGAAGATGACAAATAGGACATGG + Intronic
1056279848 9:85030373-85030395 TGTAGATGGCAGATGGGGCATGG - Intergenic
1058237920 9:102516401-102516423 AGAAGATGACAGAGGAGACAAGG - Intergenic
1058574021 9:106380857-106380879 TTAAGCTGGGAGCTGGGACAAGG - Intergenic
1058608607 9:106750866-106750888 TTTAGAAGACAGATGAGAAATGG - Intergenic
1058845674 9:108956405-108956427 TAAAGATGATAGATGGGGCAGGG - Intronic
1059032095 9:110709669-110709691 TAAAGATGACACATGGAAAAGGG - Intronic
1059286087 9:113172872-113172894 TGAAAAAGAGAGATGGGACATGG - Intronic
1059610124 9:115883618-115883640 AGATGATGACAGATGGGACCAGG - Intergenic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1186997045 X:15134665-15134687 TTGAGATGACAGATGGCAGATGG + Intergenic
1187026238 X:15438282-15438304 GCAAAATGACAGATGGGCCAAGG + Intronic
1187396505 X:18923969-18923991 TTAATATGAAAAATGGGACAAGG + Intronic
1189066022 X:37810096-37810118 TTAAGTTGACAGATGTCTCAAGG + Intronic
1189784347 X:44546015-44546037 TTAAGATGAGAGATTGGGCTGGG + Intergenic
1190727152 X:53197115-53197137 GTAAGAAGATAGGTGGGACAAGG - Intronic
1194044168 X:88981761-88981783 TTAAGATGAGAGAAGGAAGAAGG - Intergenic
1194654292 X:96553335-96553357 TTAAGATGACATGAGGGGCAAGG + Intergenic
1194671728 X:96741772-96741794 TTAAGATGAGAGACTGGGCATGG - Intronic
1194684311 X:96893789-96893811 TTAAGATGCCAGCTGGCACCTGG + Intronic
1195624809 X:106996902-106996924 ATAAGATGGCAAATGGGAGATGG + Intronic
1198305411 X:135377579-135377601 AGAAGATGACAGCTGGGATAAGG + Intergenic
1198980725 X:142391805-142391827 AGAATATGACAGATGGGAAATGG - Intergenic
1199061355 X:143358865-143358887 TTAGGGTGAGAGGTGGGACACGG + Intergenic
1199074313 X:143511755-143511777 TTGATATCACAGATGGGGCAAGG - Intronic
1199122737 X:144076202-144076224 TTGAAATGTCTGATGGGACATGG + Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199618639 X:149679539-149679561 TTAATAGGACAGATGGGCCCAGG - Intergenic
1199624003 X:149723710-149723732 TTAATAGGACAGATGGGCCCAGG + Intergenic