ID: 1099148788

View in Genome Browser
Species Human (GRCh38)
Location 12:79081849-79081871
Sequence TGTGCTCTTAGAAGCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099148788_1099148792 16 Left 1099148788 12:79081849-79081871 CCCCAGGAGCTTCTAAGAGCACA 0: 1
1: 0
2: 0
3: 9
4: 227
Right 1099148792 12:79081888-79081910 TTGAATTCATCTCACTGTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099148788 Original CRISPR TGTGCTCTTAGAAGCTCCTG GGG (reversed) Intronic
901114994 1:6836411-6836433 GGTCTTCTTAGAAGCTTCTGTGG + Intronic
901803100 1:11720636-11720658 TGTGCTCTAACAAGCTCCCAGGG + Exonic
903745496 1:25584153-25584175 TGTGCTCTTTGGAGGTCCCGTGG + Intergenic
903967908 1:27101424-27101446 TGAGCCCTTAGGAGCTCCTGAGG - Intronic
905919049 1:41707170-41707192 TGGGCTCTAAGAAGCCCCAGAGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906677586 1:47704237-47704259 TGTTCTCTTAGACCCTACTGAGG + Intergenic
907185742 1:52607791-52607813 CTTGCTTTTAGAAGCACCTGGGG + Intronic
907266345 1:53263896-53263918 TGGCCTGATAGAAGCTCCTGGGG - Intronic
907679704 1:56551625-56551647 TTTGCTCTCAGAAGTACCTGGGG - Intronic
908623459 1:66012555-66012577 TGTGCCGTTTGAAGCTCCTAGGG + Intronic
913609005 1:120492637-120492659 TGAGCTCTGAGCAGATCCTGAGG + Intergenic
913681575 1:121190926-121190948 TGTGCCCTGAGGAACTCCTGAGG + Intronic
914033410 1:143978563-143978585 TGTGCCCTGAGGAACTCCTGAGG + Intergenic
914156035 1:145089408-145089430 TGTGCCCTGAGGAACTCCTGAGG - Intronic
914204823 1:145517814-145517836 TGAGCTCTGAGCAGATCCTGAGG - Intergenic
914370742 1:147022414-147022436 TGAGCTCTGAGCAGATCCTGAGG + Intergenic
914483946 1:148091000-148091022 TGAGCTCTGAGCAGATCCTGAGG - Intergenic
914582186 1:149029201-149029223 TGAGCTCTGAGCAGATCCTGAGG - Intronic
915472885 1:156136334-156136356 CGTGCTGTGAGAAGCTGCTGCGG - Exonic
919122434 1:193358025-193358047 GGTGGTCTTAGTTGCTCCTGAGG - Intergenic
919596596 1:199571205-199571227 CATGTTCTTAGAATCTCCTGAGG + Intergenic
920468891 1:206209444-206209466 TGTGCCCTGAGGAACTCCTGAGG + Intronic
920650437 1:207833442-207833464 AGGGCTCTCAGAAGCTCCAGTGG - Intergenic
922026377 1:221753334-221753356 TCTGCTCTTTGGAGCTGCTGTGG + Intergenic
922076227 1:222247588-222247610 TGGGCTCTAAGAAGTTCTTGGGG - Intergenic
923438146 1:233988527-233988549 TGAGCTCTTTGAGGGTCCTGTGG + Intronic
924613415 1:245592047-245592069 TGTGCTCTAAGAAGCGCTTCGGG - Intronic
924645785 1:245876286-245876308 TGTATTCTTAACAGCTCCTGAGG - Intronic
1062939860 10:1413063-1413085 TGGGCTCTGCCAAGCTCCTGTGG - Intronic
1064186998 10:13170589-13170611 TGTCCCCTAAGAAGCACCTGGGG + Intronic
1065306934 10:24378013-24378035 TGTGCTCTCTGAAGATCGTGGGG + Intronic
1069178677 10:65327415-65327437 TGTGTTCTCAGGACCTCCTGAGG + Intergenic
1069410839 10:68151923-68151945 TATGTTCTCAGAATCTCCTGAGG - Intronic
1069581189 10:69568193-69568215 TGTGGTCTTATAAGGTCCAGGGG - Intergenic
1071235718 10:83645951-83645973 CATGCTCTTAGGACCTCCTGAGG - Intergenic
1074065969 10:110014160-110014182 AGTGTTCTTAGAAGTCCCTGGGG - Intronic
1074242603 10:111654195-111654217 TGTCTTCTTAGAAGTTCCAGGGG + Intergenic
1074697926 10:116067497-116067519 GGAACTCTTAGAAGCTACTGTGG - Intronic
1075944967 10:126424835-126424857 TGTGCTTCTAGATGCTCCAGTGG - Intergenic
1076460683 10:130643709-130643731 TGTCTTCTTAGAAGTTCCAGTGG - Intergenic
1076585271 10:131542824-131542846 TGTGCTGAGATAAGCTCCTGAGG + Intergenic
1077885297 11:6382913-6382935 TGTGCTCTCAGGGTCTCCTGGGG + Intergenic
1078131684 11:8619031-8619053 TGTGCTCTGTGTAGCTCTTGAGG - Intronic
1079908756 11:26283379-26283401 TCTGTTCTTAGAAGGTCCAGGGG + Intergenic
1083539268 11:63500912-63500934 TGTGTTCTCAGGACCTCCTGAGG + Intergenic
1083539417 11:63502056-63502078 TGTGTTCTCAGGACCTCCTGAGG + Intergenic
1083674936 11:64319823-64319845 TGTGCTGTTTGGAGTTCCTGGGG + Exonic
1085459304 11:76683670-76683692 TCTGTTCTTAGAGGCTCCTAAGG - Intergenic
1086886814 11:92215604-92215626 TGAGCTCCTAGAAGCTGCTCTGG + Intergenic
1089321933 11:117632251-117632273 TGCGGTCTTGGATGCTCCTGGGG + Intronic
1089773228 11:120817961-120817983 AGAGCTCTAAGAAGCACCTGTGG + Intronic
1091219740 11:133923070-133923092 TGTGCTCTGTGTAGCTCATGGGG - Intronic
1092861003 12:12718672-12718694 TGTGCCCTTAAAAGCCACTGGGG + Intronic
1094117546 12:26933721-26933743 TGTGCTCCAAGAAGTTCCTCAGG + Intronic
1095839421 12:46676084-46676106 TGTGGTCTCAGAAACTCCGGAGG + Intergenic
1096558314 12:52417927-52417949 TTTGCTCCCAGAAGCACCTGAGG + Intergenic
1097156371 12:57015158-57015180 TGGGATCTTAGAAGCACCTGAGG + Intronic
1099148788 12:79081849-79081871 TGTGCTCTTAGAAGCTCCTGGGG - Intronic
1100279747 12:93107095-93107117 TGAGCTCTCACAAGATCCTGTGG - Intergenic
1100507090 12:95232925-95232947 TGTGCTCTTAGCAACTCAGGAGG - Intronic
1101783243 12:107857533-107857555 TGTGCACTTTGAATCTACTGTGG + Intergenic
1103945494 12:124523961-124523983 TGTTCTCTGAGAAACTGCTGTGG + Intronic
1105952892 13:25247521-25247543 TGTGGTTTTAGAATCTTCTGTGG - Exonic
1106770880 13:32959530-32959552 TTTGCTGACAGAAGCTCCTGGGG - Intergenic
1107073682 13:36298495-36298517 CGTGTTCTCAGAATCTCCTGAGG - Intergenic
1107530821 13:41280678-41280700 TATGTTCTTAGGATCTCCTGAGG + Intergenic
1108463918 13:50695412-50695434 TATGTTCTTAGGACCTCCTGAGG - Intronic
1111633487 13:90873759-90873781 TGTTCTCTCTGAAACTCCTGTGG + Intergenic
1112582853 13:100691256-100691278 TGAGCTCTTACAAGCTCAAGTGG + Intergenic
1113585691 13:111462767-111462789 TGTGCTCCTGGGAGCTACTGAGG + Intergenic
1114802881 14:25798189-25798211 TGTGCTCTTAGATGATGTTGGGG - Intergenic
1117530574 14:56657091-56657113 TGTTCTCTGAGAAGTCCCTGGGG - Intronic
1118474371 14:66102805-66102827 AGTGCTATGAGAAGCACCTGAGG + Intergenic
1118846529 14:69551505-69551527 AGTGGTCTTAGAAGCTCCCAAGG - Intergenic
1119717407 14:76868673-76868695 TGTGTTCTTAAGAGCTTCTGTGG + Intronic
1121110349 14:91308398-91308420 TGTGCTCTTAGAAGCACAGATGG - Exonic
1121835578 14:97089083-97089105 TCTGCTCTCTGAAGCTGCTGGGG - Intergenic
1123048654 14:105530345-105530367 GGGGCTCTCAGGAGCTCCTGGGG + Intergenic
1124833606 15:33173975-33173997 TGACCTCTTAAAAGCTCCTTCGG - Intronic
1125396463 15:39253612-39253634 TGGACTCTTAGAAGCAACTGAGG - Exonic
1126124785 15:45285375-45285397 CGTGTTCTTAGGACCTCCTGAGG + Intergenic
1127857527 15:62964838-62964860 AGTACTCTTAGTAGCTTCTGGGG - Intergenic
1129250504 15:74306270-74306292 TGTGCTCCCACAATCTCCTGAGG - Intronic
1129814247 15:78538161-78538183 TGTCTTCTTAGAAGTTCCAGGGG - Intergenic
1129817380 15:78566387-78566409 TGTGCTCTAAGGAGCTAGTGAGG - Intronic
1131494792 15:92898279-92898301 TGTGCTCTTAGATGGTCATTTGG + Intronic
1132205841 15:99985586-99985608 TGAGCTCTAAGATGCTCATGTGG - Intronic
1133561208 16:6952126-6952148 TGTGCTCTGCGAAGCACTTGTGG - Intronic
1133748871 16:8708826-8708848 GGTGCTCTTACAAGCTACAGAGG - Intronic
1134119074 16:11571029-11571051 TGTGCTCCTGGAGGCTCCTGGGG - Intronic
1134171218 16:11971289-11971311 TGTGTTCTCAGAATCTCCTGAGG - Intronic
1136268183 16:29132881-29132903 TCTGCTCTCAGAAACTCGTGGGG - Intergenic
1138081474 16:54094952-54094974 TGAGCTCTTGGAAGCCACTGTGG - Intronic
1138217421 16:55216593-55216615 TGTGCACCTAGAAGGTCCTTGGG + Intergenic
1139638178 16:68271687-68271709 TGTGCTCTTGGGAGCTGCTAGGG + Intronic
1140408094 16:74724345-74724367 CGTGCTCTCAGAAGCTGCTCTGG + Intronic
1142174677 16:88639622-88639644 TGTGCTCTTGGAGGGCCCTGGGG + Intronic
1142589596 17:996744-996766 GGGGCTCTTACGAGCTCCTGAGG - Intergenic
1143439639 17:6959517-6959539 TGTGCTGAGAGAAGCTCCTTTGG + Intronic
1143718213 17:8790909-8790931 TGTGCTCTTATAGTCACCTGAGG + Intergenic
1147586282 17:41655516-41655538 TGCTCACTCAGAAGCTCCTGGGG + Intergenic
1153744894 18:8167628-8167650 TGTGTTCTTGGAAGCATCTGTGG + Intronic
1155163007 18:23210760-23210782 TGTGTTCTTGGAAGCTCCATTGG + Intronic
1155820674 18:30371170-30371192 GGTACTCTTAGAAGTTCCAGGGG - Intergenic
1157624815 18:49042406-49042428 TGTGCTCTTAGAGGCTGTCGAGG - Exonic
1157697646 18:49735811-49735833 TGGTCCCTTCGAAGCTCCTGTGG - Intergenic
1159008789 18:63039001-63039023 TCTGCTCTTACAAGCGCCAGGGG + Intergenic
1159412162 18:68093026-68093048 TGTAGTCTTAGCTGCTCCTGAGG - Intergenic
1163666040 19:18604549-18604571 TGTCATCTTTGCAGCTCCTGGGG - Intronic
1167067624 19:47198756-47198778 AGTGGTCTTTGAAGCACCTGTGG + Intronic
925010602 2:482716-482738 TATACGCTTAGATGCTCCTGTGG + Intergenic
925629470 2:5875395-5875417 GGTGCTCTTCTAAGCTCATGTGG + Intergenic
927147218 2:20174100-20174122 TGGGCTCCAAGAAGCCCCTGGGG + Intergenic
927724482 2:25410852-25410874 TGTGTTCTCAGGATCTCCTGAGG - Intronic
929062213 2:37933940-37933962 TGTCCTTTTATAATCTCCTGTGG + Intronic
930164226 2:48187950-48187972 TGTGTTCTCAGGATCTCCTGAGG + Intergenic
932098769 2:68877178-68877200 TGTGCTCTTAGAATCACTAGAGG + Intergenic
932500321 2:72177587-72177609 TGAGCTCATAGATGCTGCTGAGG - Exonic
933297195 2:80504162-80504184 TGTTTTCTTCCAAGCTCCTGTGG + Intronic
936157655 2:110058980-110059002 TCTGCTCTTACAAGTTCCTAAGG + Intergenic
936187037 2:110312464-110312486 TCTGCTCTTACAAGTTCCTAAGG - Intergenic
938161564 2:128988991-128989013 TGTGCACTTTGAAGGCCCTGTGG + Intergenic
939791988 2:146588981-146589003 TGTGCTTTAAGATGCTGCTGAGG - Intergenic
940660887 2:156543851-156543873 TATGCACTAAGTAGCTCCTGTGG + Intronic
945682818 2:212934510-212934532 TGTCCTCTTAGCAGCTCCAAGGG + Intergenic
946738919 2:222782627-222782649 GGTGCTCTTAGAAGCTAGTGTGG + Intergenic
948011114 2:234649767-234649789 CGTGCTCTCAGTATCTCCTGAGG - Intergenic
948298615 2:236885009-236885031 TCTGCTACTAGATGCTCCTGGGG + Intergenic
1170358136 20:15515174-15515196 GCTGCTCTTATAAGCTCCTAAGG + Intronic
1172161489 20:32871897-32871919 TGTGCTTTCAAAACCTCCTGGGG - Intronic
1175023972 20:55881788-55881810 TGTGTTCTTAGTGTCTCCTGAGG - Intergenic
1175959326 20:62627072-62627094 TGTGTTCTTAGGAGATCTTGTGG - Intergenic
1177156615 21:17507243-17507265 TGTGTTCTCAGGACCTCCTGAGG + Intergenic
1177189782 21:17838334-17838356 TGTTCTCTTATAAAGTCCTGTGG - Intergenic
1178368440 21:32007168-32007190 TGGGCTCTCAGAAGGGCCTGTGG + Intronic
1178905156 21:36630658-36630680 TGTGATGTTAGATGGTCCTGGGG + Intergenic
1182390030 22:29985988-29986010 AATGCTCTTAGCAGCTGCTGGGG - Intronic
1183235377 22:36612954-36612976 TCTCCTCTTAGCATCTCCTGGGG - Intronic
1183430346 22:37761970-37761992 TCTGCTCTAAGAAGCTGCAGGGG + Intronic
1183777493 22:39976214-39976236 TGTGCTCATGGAAGATGCTGAGG - Intergenic
1183865822 22:40703391-40703413 TGTGTTCTCAGATCCTCCTGGGG + Intergenic
950300417 3:11872528-11872550 TGTGCTCTTCTAAGCTTCTACGG - Intergenic
953366880 3:42352708-42352730 TCTGCCCATAGAGGCTCCTGGGG + Intergenic
953485313 3:43289069-43289091 TAGGTTCTTAGAAGCTACTGGGG + Intronic
959145258 3:102536396-102536418 TTTGCTATCAGCAGCTCCTGAGG - Intergenic
961016800 3:123474730-123474752 TGGGTTCCTTGAAGCTCCTGGGG + Intergenic
961225068 3:125236723-125236745 TGTGCTCTTTCAAGCTCGAGAGG + Intronic
963218816 3:142782797-142782819 TGTGGTCTGAGAAGCCTCTGCGG + Intronic
968871231 4:3243617-3243639 TCTGCTCTTAGAAACAACTGAGG - Exonic
968967521 4:3776588-3776610 TGTTCTCTGAGAATCACCTGAGG - Intergenic
969072904 4:4553655-4553677 GGTGCTCTATGAAACTCCTGGGG - Intergenic
969835574 4:9837482-9837504 TGTGTTTTTGGAAGCACCTGTGG + Intronic
970082167 4:12299841-12299863 CATGCTCTCAGAACCTCCTGAGG - Intergenic
970088783 4:12379281-12379303 TGTTGTCTGAGAAGCTCCTCAGG + Intergenic
970311156 4:14783871-14783893 TGTGCTTTTTGAAGGTCCTAAGG + Intergenic
972046851 4:34676488-34676510 TGTGGTCTTAGATCCTGCTGAGG + Intergenic
979519881 4:121653839-121653861 TGTGCTCTTAAAATTTCATGAGG + Intergenic
982064314 4:151639744-151639766 TGTGCTCTTACATGCTCTTCTGG + Intronic
983428232 4:167615015-167615037 TGGGTTCTGAGAAGGTCCTGCGG - Intergenic
983436740 4:167724869-167724891 TATTTTCTTAGAAGCTTCTGGGG - Intergenic
984478091 4:180262882-180262904 TGTGCTCTTTAAACCTCCTATGG - Intergenic
984975131 4:185223499-185223521 TGTGCTCTTAGAAGTCACGGTGG + Intronic
985638956 5:1054262-1054284 TCTGCTCTCTGAAGCTGCTGTGG + Intronic
985987730 5:3531493-3531515 TGTGCTCTGGGAGGTTCCTGGGG - Intergenic
987950232 5:24665184-24665206 TGTTCTCTTGGCAACTCCTGTGG - Intergenic
988017353 5:25575998-25576020 CATGTTCTCAGAAGCTCCTGAGG + Intergenic
991001561 5:61788652-61788674 TGTGGTCTAAGAAGCCCCTAAGG - Intergenic
991314225 5:65282183-65282205 TATGTTCTTAGGATCTCCTGGGG - Intronic
991592155 5:68264673-68264695 TTTGCTCTTTGTATCTCCTGTGG - Intronic
992859658 5:80897660-80897682 GGTACTATTAGAAACTCCTGTGG + Intergenic
994125504 5:96165425-96165447 TGTGCTTTTAGAAAGTACTGGGG + Intergenic
994933585 5:106221718-106221740 TTTGGGCATAGAAGCTCCTGTGG + Intergenic
995593421 5:113723658-113723680 CATGTTCTTAGGAGCTCCTGAGG - Intergenic
996193011 5:120568313-120568335 TGTACTGTTAAAAACTCCTGAGG + Intronic
996895370 5:128474924-128474946 TGTCCTCTTAGAATGTCCTACGG - Intronic
996954748 5:129169482-129169504 TGTGCTCTGAAATCCTCCTGAGG + Intergenic
997356649 5:133266961-133266983 TGTGCTCTTAGAAGGCACTGGGG - Intronic
998701564 5:144708016-144708038 TGTGCACATAGAAACTCCTATGG + Intergenic
1000933679 5:167282884-167282906 TGTCCTCTAAGCAGGTCCTGGGG + Intergenic
1005652843 6:27900352-27900374 CGTGTTCTTAGGACCTCCTGAGG + Intergenic
1013651884 6:112203243-112203265 TTTGCTCTTAGAAAATCCTTAGG + Intronic
1015237102 6:130984148-130984170 TGTGCTTTTAGAAGGTCCGCAGG + Intronic
1018277824 6:162152041-162152063 TTTGTTATTAGAAGCTCATGTGG - Intronic
1019068418 6:169321972-169321994 TGTGTTCTCAGGACCTCCTGGGG - Intergenic
1020958431 7:14772176-14772198 TATGTTCTCAGAACCTCCTGAGG + Intronic
1023310552 7:38882153-38882175 AGTGCTCTTAGAATCACCGGTGG + Intronic
1023558121 7:41444602-41444624 TTTGCACTTAGAAGCAGCTGTGG - Intergenic
1023829941 7:44033285-44033307 TGTTCTGTAAGAAGCTCCTTGGG + Intergenic
1024823964 7:53367476-53367498 TGTGCTCTTAGAAAGCACTGAGG + Intergenic
1028204027 7:87995658-87995680 TGTGCTTTTAGAAGCTCTCTGGG + Intronic
1029740255 7:102487557-102487579 TGTTCTGTAAGAAGCTCCTTGGG + Intronic
1029758251 7:102586731-102586753 TGTTCTGTAAGAAGCTCCTTGGG + Intronic
1029776189 7:102685809-102685831 TGTTCTGTAAGAAGCTCCTTGGG + Intergenic
1032677235 7:134142153-134142175 TGCGCTATTACAACCTCCTGGGG - Intronic
1032718686 7:134532504-134532526 TCTGCTCTTACCTGCTCCTGAGG + Intronic
1032723634 7:134571095-134571117 TCTGCTCTTACCTGCTCCTGAGG + Intronic
1033668765 7:143469400-143469422 TGGCCTCATGGAAGCTCCTGAGG - Intergenic
1033869051 7:145727734-145727756 ATTGGTTTTAGAAGCTCCTGAGG + Intergenic
1034465068 7:151223053-151223075 TGTGTTTTTAAAAGCTCCTTGGG + Intronic
1035075068 7:156172033-156172055 TTTGCTCATATAAGTTCCTGGGG - Intergenic
1035237177 7:157506091-157506113 TGTGGTCTTTCAAGTTCCTGAGG + Intergenic
1035262028 7:157668009-157668031 CGTGCTCTGAGCAGCTCCTCAGG + Intronic
1035476585 7:159148518-159148540 TGTGTTCTTGGGACCTCCTGAGG + Intergenic
1036601543 8:10265302-10265324 TTGGCTCTTGGAAGATCCTGGGG + Intronic
1036637672 8:10563198-10563220 TATGTTCTCAGAACCTCCTGAGG + Intergenic
1038490645 8:27968121-27968143 TGTGGTCATAAAACCTCCTGAGG - Intronic
1039286578 8:36048269-36048291 GGTGCTCTTCCAAGCTCATGTGG + Intergenic
1041110240 8:54476726-54476748 TGTGCTCTTGGATGGTTCTGGGG - Intergenic
1045763841 8:105644119-105644141 TCTGCTCTTGGATGCTTCTGTGG + Intronic
1046810446 8:118527294-118527316 TGTGCTGTGGGAAGCTCCTGTGG - Intronic
1048996023 8:139794172-139794194 TCTGCTCTCAGGAGCTCCTGGGG - Intronic
1053017234 9:34669174-34669196 TGTGTTGTCAGAACCTCCTGAGG + Intergenic
1055356124 9:75438761-75438783 TGTGCTCTCAGAAGGTCAGGTGG + Intergenic
1055436721 9:76298996-76299018 TGTGCTGATAGATGCTCATGGGG - Intronic
1056289259 9:85126255-85126277 TATGCTCTCAGGATCTCCTGAGG + Intergenic
1056719632 9:89060633-89060655 TGAGCTCACAGAAGGTCCTGTGG + Intronic
1057964392 9:99489013-99489035 TGTGTCCTCTGAAGCTCCTGTGG + Intergenic
1060840509 9:126789621-126789643 GGTGCTCATAGGAGGTCCTGGGG + Intergenic
1061538797 9:131266214-131266236 TGTGTTTTTAGAAGATCCTTCGG - Intronic
1061772678 9:132938249-132938271 TGTGATCTGTGAACCTCCTGAGG + Intronic
1062315882 9:135966850-135966872 GGCGCTCTCAGAACCTCCTGTGG + Intergenic
1062367405 9:136217609-136217631 TGTGCTCTGGGCAACTCCTGAGG - Intronic
1062565576 9:137162595-137162617 TGCGCGCTGAGAAGCTTCTGGGG - Exonic
1188359410 X:29234037-29234059 GGTGCTCTTCCAAGCTCATGTGG - Intronic
1188751293 X:33908549-33908571 CGTGTTCTCAGAATCTCCTGGGG + Intergenic
1189232099 X:39460489-39460511 TCTGCTCTTAGCAGCTTCTGTGG - Intergenic
1192032168 X:67525346-67525368 TCTGATTTTAGAAGCCCCTGAGG + Intergenic
1192555998 X:72089702-72089724 TCTGCTCTGAGAAGCCACTGGGG + Intergenic
1193708706 X:84855021-84855043 TGTGTTCTCAGGACCTCCTGAGG - Intergenic
1193710566 X:84873869-84873891 TGTGTTCTCAGGACCTCCTGAGG + Intergenic
1193718293 X:84957745-84957767 TGTGTTCTCAGGACCTCCTGAGG - Intergenic
1196519493 X:116656260-116656282 TGTGCTCTTACTACCCCCTGCGG + Intergenic
1197305437 X:124835654-124835676 TGACCTCTTAGAAGCTAATGTGG - Intronic
1197548442 X:127857101-127857123 TGTGCTGATAGAAGTTCATGTGG - Intergenic
1200069411 X:153520305-153520327 TCAGCTCTCAGAAGCCCCTGGGG - Intronic
1201261066 Y:12159321-12159343 TGTGTTCTTCGGATCTCCTGGGG + Intergenic