ID: 1099153327

View in Genome Browser
Species Human (GRCh38)
Location 12:79143127-79143149
Sequence TGTTCTTAAGAATCCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099153327_1099153330 8 Left 1099153327 12:79143127-79143149 CCAAAAATGGATTCTTAAGAACA 0: 1
1: 0
2: 0
3: 27
4: 373
Right 1099153330 12:79143158-79143180 TAAGATCTTTCCATGTTGCTAGG 0: 1
1: 0
2: 1
3: 29
4: 337
1099153327_1099153332 26 Left 1099153327 12:79143127-79143149 CCAAAAATGGATTCTTAAGAACA 0: 1
1: 0
2: 0
3: 27
4: 373
Right 1099153332 12:79143176-79143198 CTAGGAGCAATTGTTACCATAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099153327 Original CRISPR TGTTCTTAAGAATCCATTTT TGG (reversed) Intronic