ID: 1099157900

View in Genome Browser
Species Human (GRCh38)
Location 12:79202521-79202543
Sequence AAGAAGAAAGAGAAGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2581
Summary {0: 1, 1: 0, 2: 22, 3: 304, 4: 2254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099157900 Original CRISPR AAGAAGAAAGAGAAGGAGTC AGG Intronic
Too many off-targets to display for this crispr