ID: 1099160593

View in Genome Browser
Species Human (GRCh38)
Location 12:79236721-79236743
Sequence ATGGATAAACAGCTTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099160591_1099160593 13 Left 1099160591 12:79236685-79236707 CCTACAAGGAGAAAACAGTCAAC 0: 1
1: 0
2: 1
3: 23
4: 293
Right 1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG 0: 1
1: 0
2: 0
3: 13
4: 249
1099160590_1099160593 14 Left 1099160590 12:79236684-79236706 CCCTACAAGGAGAAAACAGTCAA 0: 1
1: 1
2: 3
3: 24
4: 266
Right 1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG 0: 1
1: 0
2: 0
3: 13
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099160593 Original CRISPR ATGGATAAACAGCTTGATGA TGG Intronic
901001374 1:6150548-6150570 ATGGACAAATGGATTGATGATGG + Intronic
902159822 1:14520878-14520900 ATGGATGAACAGTTTGCTGCAGG - Intergenic
902670675 1:17971192-17971214 ATGGATGAACACCATGGTGATGG + Intergenic
907072297 1:51547330-51547352 ATGCATACACAGCAAGATGAAGG + Intergenic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
908169595 1:61491548-61491570 ATTGAGAAATACCTTGATGAGGG - Intergenic
909338848 1:74509007-74509029 ATGGATAAACCCCTTTCTGAGGG + Intronic
909988635 1:82193868-82193890 ATGGTTTAATAGCTTCATGAGGG + Intergenic
910166169 1:84329573-84329595 ATGGAGAAGCAGCTGGATTAAGG + Intronic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916648684 1:166815386-166815408 ATGGATTAACCGATTGATCAGGG + Intergenic
916810968 1:168305258-168305280 ATGGATAAACAGCTAGGAAAAGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918861847 1:189838007-189838029 ATGAATATATAGCATGATGAAGG + Intergenic
919059910 1:192619323-192619345 ATGGAAAAACTCTTTGATGATGG - Intergenic
920700584 1:208215517-208215539 GTGGATAAAGAGATGGATGAAGG + Intronic
921600167 1:217098212-217098234 ATTTATAAAGAGCTTGCTGATGG - Intronic
922375003 1:224954133-224954155 ATGGATAGACATTTTAATGAAGG + Intronic
922972178 1:229751846-229751868 CTGGTTTAACAGCATGATGATGG + Intergenic
924174361 1:241374845-241374867 AAGGATAAACACATAGATGAAGG + Intergenic
1063454199 10:6171767-6171789 ATAGATAAACAGGTTGTTGGGGG + Intronic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1065409775 10:25411992-25412014 ATGGAAATAAAGCTTCATGAGGG - Intronic
1066517044 10:36174096-36174118 ATGGGTAAACATTTTGATGGTGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1071703528 10:87970111-87970133 ATGGAAAAACAGCAAGATTATGG - Exonic
1072076586 10:91980846-91980868 ATTGATAAACAGCAAGATGAGGG - Intronic
1072374961 10:94804701-94804723 GTGGACAAACAGCCTCATGATGG - Intronic
1072475929 10:95759690-95759712 TTGGATAAACAGTTTGCTCACGG + Intronic
1073619449 10:105031540-105031562 ATGGATGAACATTTTGATTAAGG - Intronic
1074479482 10:113806151-113806173 ATGTACAAACAGCTTGCTGTGGG - Intergenic
1079198022 11:18347655-18347677 ATGGTTAAATCTCTTGATGATGG - Exonic
1080062406 11:27971070-27971092 AAGTATAAACACCTTCATGAGGG - Intergenic
1082701852 11:56441902-56441924 GTGGATAAGCAGCTGGATGTTGG - Intergenic
1084852541 11:71954161-71954183 ATGAATAAACTCCTTAATGAGGG + Intronic
1088845730 11:113664850-113664872 TTAGATAAACATCTTTATGAGGG - Intergenic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1096273589 12:50186563-50186585 TTGGATAAGCATCTTTATGAGGG - Intronic
1096527413 12:52219417-52219439 ATGGATAGATAGATAGATGATGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1098567102 12:71948950-71948972 ATGGATAAAAATCTTGAAGTTGG + Intronic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1103731609 12:123031619-123031641 TCGGATAGACAGCTTGGTGATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104968031 12:132518239-132518261 ATGGACAGACAGGTGGATGATGG - Intronic
1105764065 13:23540861-23540883 TTAGATAAACATCTTTATGAGGG + Intergenic
1107391618 13:39970640-39970662 ATGGAAAAACCCTTTGATGATGG - Intergenic
1107722943 13:43267760-43267782 TTGGACAAACAGCTTGGTAATGG + Intronic
1109611069 13:64765099-64765121 ATTGATAATTAGCTAGATGAGGG - Intergenic
1111859857 13:93689234-93689256 TTAAATAAACAGCTTGCTGAAGG + Intronic
1112598993 13:100836658-100836680 ATAAATAAAAATCTTGATGATGG + Intergenic
1114075580 14:19159526-19159548 ATGGATAAACAGTTTACAGATGG - Intergenic
1114086581 14:19240046-19240068 ATGGATAAACAGTTTACAGATGG + Intergenic
1114851450 14:26387003-26387025 AAAGATAAACATCTTTATGAGGG + Intergenic
1116016706 14:39416380-39416402 ATGGATATTCAGATTCATGAAGG - Intronic
1117238809 14:53807149-53807171 ATGGACAGACAGCTGGATGAGGG + Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1118589963 14:67393808-67393830 TTAGATAAACATCTTTATGAGGG - Intronic
1119919890 14:78437006-78437028 AAGGATAAGCAACTTGCTGAAGG - Intronic
1122011124 14:98749078-98749100 ATGGATAGATAGATAGATGATGG + Intergenic
1202898118 14_GL000194v1_random:21664-21686 ATGGATAAACAGTTTACAGATGG + Intergenic
1126309501 15:47299723-47299745 AGGGAAAAACAGCTTTTTGATGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126395799 15:48215868-48215890 ACGGTTAAACACCTTGATGGAGG + Intronic
1126693859 15:51309395-51309417 ATGGTTAATCTGCTTTATGAAGG + Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133653855 16:7840174-7840196 ATTGATAAACAGAATGATTAGGG - Intergenic
1138815015 16:60193988-60194010 ATAGATAAACAGCCAGATGGAGG + Intergenic
1140989862 16:80200134-80200156 CTGGATATTAAGCTTGATGAAGG + Intergenic
1141110152 16:81265491-81265513 ATGGATAAATGGATTCATGATGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141273762 16:82565743-82565765 ATGGAGAAAAAGCTCCATGATGG + Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141866448 16:86753142-86753164 ATGGAGACCCAGCTTGCTGAGGG + Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142526341 17:544195-544217 ATGAATATACACCATGATGATGG + Intronic
1143538530 17:7556364-7556386 ATGGATAGACATTTTGTTGATGG + Intronic
1146718684 17:35107424-35107446 CTTGATAAACTGCTTGATGCTGG - Exonic
1147891313 17:43719242-43719264 ATTGATTAACAGCCTGAAGAGGG - Intergenic
1149360456 17:55889560-55889582 ATAGATAAACATCTGGATGAAGG - Intergenic
1152487413 17:80603103-80603125 AAAAATAAACAGCATGATGAGGG - Intronic
1153278730 18:3394412-3394434 ATTGTTAATCAGCTTGATTACGG + Intergenic
1154179218 18:12116180-12116202 ATGGATAACTATCTTGATTATGG - Intronic
1156255249 18:35389057-35389079 ATAGATAAACCACTTGAAGAAGG + Intergenic
1156922505 18:42539958-42539980 ATGGACAAAAAGCTTGAACAGGG + Intergenic
1156992728 18:43429580-43429602 CTGGCAAAACAGGTTGATGAAGG + Intergenic
1157433319 18:47648697-47648719 ATGGGTAAATATCTTGATTATGG + Intergenic
1159039243 18:63307753-63307775 ATAGATAAGCTGCTTGAAGAGGG + Intronic
1160293202 18:77614034-77614056 ATGGATAGATAGCTACATGATGG - Intergenic
1163410919 19:17154109-17154131 ATACATAAACAGCTTGAGGCCGG - Intronic
1164612108 19:29639524-29639546 AAGAATAAACAGCCAGATGAAGG + Intergenic
1164706544 19:30324275-30324297 AAGGATAAAAAAATTGATGATGG - Intronic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
925249896 2:2423143-2423165 ATGGAAATACAGATTGATGCAGG + Intergenic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
927379661 2:22464476-22464498 ATTGATAAACAGTAAGATGATGG + Intergenic
927906483 2:26862282-26862304 ATTGATAACCAACTTGCTGAGGG - Intronic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
932328726 2:70884000-70884022 ATGCACAAAGAGCTTGATGAGGG + Intergenic
934906185 2:98206358-98206380 GTGGATATCCAGTTTGATGAGGG + Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
936887808 2:117334035-117334057 ATGGATACACTGCTGGATGGAGG + Intergenic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
938490170 2:131757026-131757048 ATGGATAAACAGTTTACAGATGG - Intronic
939861629 2:147427818-147427840 CTAGATAAGCAGCTTGCTGAAGG - Intergenic
940502468 2:154510249-154510271 ATGGATTAAAAGCTAGCTGAGGG + Intergenic
942048980 2:172121163-172121185 AGGGAGAAACACCTTGATGTTGG - Intergenic
942352804 2:175071073-175071095 ATAGATAAAAAGTTTCATGAAGG - Intergenic
942508292 2:176667561-176667583 ATGATAAAACTGCTTGATGATGG + Intergenic
942633018 2:177972500-177972522 AAGGATAAACATCTTGAGGGAGG - Intronic
945600181 2:211852659-211852681 GTGGATAGACAGCTTAGTGATGG - Intronic
945624230 2:212181075-212181097 ATGGTTAAACAACTTGCTTAAGG + Intronic
945936324 2:215906128-215906150 ATGAATATAAACCTTGATGAGGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946169162 2:217884211-217884233 ATGGATGGACAGATTAATGAAGG + Intronic
948618000 2:239213833-239213855 ATGAGTACACAGCTGGATGAGGG + Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1168731858 20:90866-90888 ATGATTAAACAGCTTGAAGGAGG - Intronic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169535393 20:6533485-6533507 ATTTTTAAACAGCTTGTTGATGG + Intergenic
1171491268 20:25519603-25519625 ATGGATAAACAAATTGATACAGG + Intronic
1172796433 20:37542402-37542424 TTAGATAAACATCTTTATGAGGG + Intergenic
1173917825 20:46722500-46722522 CTGGATAAGCATCTTTATGAAGG + Intronic
1174737776 20:52982021-52982043 ATAGAAAAAAAGCTTCATGATGG + Intronic
1175281915 20:57809536-57809558 GTGGATAAAGACCCTGATGAGGG + Intergenic
1175297384 20:57918331-57918353 AGGGATCAGCAGCTTGATTAAGG + Intergenic
1175611746 20:60357534-60357556 ATGGATAAACACCTCTGTGAAGG - Intergenic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1176617802 21:9037653-9037675 ATGGATAAACAGTTTACGGATGG + Intergenic
1177017693 21:15813053-15813075 AAAGATGAACAGCTTAATGAAGG - Intronic
1177295354 21:19166487-19166509 ATGGATGAACCGCCAGATGAAGG - Intergenic
1179271453 21:39854207-39854229 ATGGATAAATAGCTGCAGGAAGG - Intergenic
1180626938 22:17199739-17199761 AAGGTCAAAGAGCTTGATGAAGG - Intronic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1184390116 22:44198986-44199008 ATGGATAGATAGGTAGATGATGG - Intronic
1185143677 22:49117700-49117722 ATGGAAAAACAGCTGCCTGATGG + Intergenic
951222450 3:20083106-20083128 ATTGATGCACATCTTGATGAGGG + Intronic
951712887 3:25603118-25603140 ATGGGTGAACAGTTTGATGAAGG + Intronic
952557345 3:34547839-34547861 AGGAATAAACAGGTTCATGAAGG - Intergenic
952806327 3:37356840-37356862 CTTGATAAACATCTTGATGTTGG + Intronic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
956861048 3:73324013-73324035 ATAGATAAAGAAATTGATGAGGG + Intergenic
957388816 3:79534712-79534734 ATGGATTGGCAGTTTGATGAGGG - Intronic
958569292 3:95859630-95859652 GTTGAGAAACAGCTTGTTGAAGG - Intergenic
958728015 3:97929884-97929906 AAAGATAAAAAGCTTGATGGAGG - Intronic
959663823 3:108899618-108899640 ATGGAGCAAAAGCTTGATGGAGG + Intergenic
960295838 3:115943129-115943151 ATGAACAAACATCTTGAAGAAGG + Intronic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
961825341 3:129596416-129596438 AATGAGAAACAGCTTCATGAAGG - Intronic
964311797 3:155401903-155401925 ACAGATAAACAGCCAGATGAAGG + Intronic
966251875 3:177875161-177875183 ATGGATACACAGGTTCATGTTGG + Intergenic
969380081 4:6789639-6789661 TTGCATAAACAGATTCATGATGG + Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
970168759 4:13267312-13267334 ATAAATAAACAGCTTGGAGAAGG - Intergenic
970406152 4:15766306-15766328 AAGGAAAAACAACTGGATGAGGG + Intergenic
970615421 4:17764307-17764329 ATCGATAAACTGCTTTGTGAAGG - Intronic
970646893 4:18132359-18132381 ATGCATAAACAGTCTAATGAAGG + Intergenic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972423596 4:38912328-38912350 AGGGATAACCAGCTTGACAACGG - Intronic
973541900 4:51943140-51943162 GAGGATAAATAACTTGATGAAGG + Intergenic
974309848 4:60191122-60191144 ATAGAAAAACATCTTGATCATGG + Intergenic
974945083 4:68516571-68516593 ATCAATAAACAACTTGATGAAGG - Intergenic
974954991 4:68627842-68627864 ATCAATAAACAACTTGATGAAGG - Intronic
975245281 4:72113403-72113425 ATGGCTAAATGGATTGATGAAGG - Intronic
976264387 4:83176451-83176473 ATGGATAAGCAGCTTGAGCTGGG - Intergenic
977035614 4:91948744-91948766 AATAATAAACATCTTGATGATGG - Intergenic
978151733 4:105444167-105444189 ATGAATGAACAGTTTGGTGAAGG + Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
980572553 4:134639628-134639650 CTGGATAAGCAGTTTGATGTTGG - Intergenic
982706862 4:158719888-158719910 AAGGATACACAGCGAGATGACGG + Intronic
983121739 4:163894021-163894043 ATGGATAAACAACTTAATTGAGG - Intronic
984998384 4:185460331-185460353 ATGGATAAAATGCTTGTTTAGGG - Intronic
985027168 4:185749251-185749273 ATAGCTCAACAGCCTGATGATGG + Intronic
985799882 5:1998334-1998356 ATGGGTAAACATCATGGTGATGG + Intergenic
986072900 5:4304578-4304600 ATGGATGAACGGGTAGATGATGG - Intergenic
986681091 5:10233274-10233296 ACTGAGACACAGCTTGATGAAGG + Intronic
987304057 5:16621431-16621453 ATGGATAAAGACCCTGAAGAAGG + Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
988354498 5:30155745-30155767 ATTGATAAAAAGTTTAATGAGGG - Intergenic
989436341 5:41417693-41417715 ATGGCTTAACAGCTTTGTGATGG - Intronic
990669739 5:58114727-58114749 AAGGACAAAGAGCTTGCTGAAGG - Intergenic
990683045 5:58267691-58267713 ATAGGTATACAGCTTTATGATGG - Intergenic
991137499 5:63199409-63199431 ATGGATAGAGAGCTTAAAGATGG - Intergenic
991174936 5:63676650-63676672 ATGAATAAACAGCTTTGTTAAGG - Intergenic
993096417 5:83484322-83484344 ATGGATGAATAGATAGATGATGG - Intronic
993127160 5:83849786-83849808 ATAGAAAAACAGTTTTATGAAGG + Intergenic
994946441 5:106398919-106398941 ATGGATAGATAGCTAAATGACGG + Intergenic
997131771 5:131284232-131284254 TTGGATAAAAAGCTTTCTGAAGG - Intronic
997753156 5:136369528-136369550 ATGGATTAACACCTTTATGCTGG + Intronic
998610476 5:143682849-143682871 AAGGATAAACAGTTTCATAATGG + Intergenic
999000652 5:147919091-147919113 AGTCATAAACAGCTTGGTGAAGG - Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
1001916843 5:175569029-175569051 ATGGTGATACAGCTGGATGAGGG + Intergenic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008823024 6:55656729-55656751 ATGGATAAACTGCTTGCTTTAGG - Intergenic
1009539917 6:64941506-64941528 ATGGATATACTGCATGATGCTGG + Intronic
1010664337 6:78610102-78610124 ATGCATAAACAGCTCCATAATGG - Intergenic
1011642074 6:89425153-89425175 ATACATAAATAGCTTGATGGTGG + Intergenic
1013692790 6:112666394-112666416 ATACATAAATAGCTTGTTGAAGG + Intergenic
1014783339 6:125589533-125589555 AAGTATAAATAGGTTGATGAAGG - Intergenic
1016098634 6:140069474-140069496 ATGGGTAAAAATCTTGCTGATGG - Intergenic
1016563483 6:145424260-145424282 ATAGAGAAACAGCTGGATGAGGG + Intergenic
1017667516 6:156735455-156735477 AAAGAAAGACAGCTTGATGAGGG + Intergenic
1018506906 6:164481690-164481712 ATGAAAAAATATCTTGATGAAGG - Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019710251 7:2515123-2515145 ATGGATGAACAGTTAGATGGAGG - Intronic
1020365095 7:7372466-7372488 ATGAATAAACAGGTTGATATCGG - Intronic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022611942 7:31884672-31884694 ATGGATAAAGAGCTAGAGAAAGG - Intronic
1026696941 7:72603305-72603327 ATGGATGGACAGATAGATGATGG + Intronic
1028299055 7:89173764-89173786 TTAGATATACAGCTAGATGATGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033530521 7:142258233-142258255 ATGGATAAACAGTGACATGAAGG - Intergenic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035928326 8:3753825-3753847 TTGGATAAATAGCTTGAAAATGG - Intronic
1037375382 8:18221767-18221789 AATGATAAACAGCTTGTTCATGG - Intronic
1038007654 8:23446655-23446677 AAGGATAATCAACTTGTTGAGGG + Intronic
1038918992 8:32061375-32061397 ATTGAGAAACAGTTTTATGAGGG - Intronic
1039594151 8:38776146-38776168 ATGGATTTACATATTGATGAAGG - Intronic
1045091201 8:98745095-98745117 TTAGATAAACATCTTTATGAGGG - Intronic
1045101380 8:98847984-98848006 CTGAATAAACAGCATGCTGAAGG - Intronic
1045192508 8:99896728-99896750 TTAGATAAACATCTTTATGAGGG - Intergenic
1045670257 8:104543482-104543504 AGGGAGAGACAGCTTGTTGATGG - Intronic
1045716422 8:105051796-105051818 ATGTATAAACTGCTTGGAGAGGG - Intronic
1045769708 8:105721706-105721728 ATGGATAGAAGGCCTGATGAAGG - Intronic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050289133 9:4135791-4135813 ATGCAAAAACAGATCGATGAAGG + Intronic
1053644529 9:40112754-40112776 ATGGATAAACAGTTTACAGATGG - Intergenic
1053761453 9:41352097-41352119 ATGGATAAACAGTTTACAGATGG + Intergenic
1054350225 9:64013642-64013664 ATGGATAAACAGTTTACAGATGG + Intergenic
1054540046 9:66263215-66263237 ATGGATAAACAGTTTACAGATGG + Intergenic
1054936711 9:70696071-70696093 TTGGACAATCAGCTTGAAGAAGG + Intronic
1054936952 9:70698250-70698272 ATGGAGAATCGGCTTGAAGAAGG - Intronic
1055854615 9:80670550-80670572 TGGGAGAAACAGCTGGATGAGGG - Intergenic
1058304030 9:103414193-103414215 ATGTAAAAACAGCTTTAAGATGG - Intergenic
1058609399 9:106758438-106758460 TTGGAAAAACAGCTTGATCTGGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059369521 9:113815830-113815852 ATTCATAAACAGCGTGATGAAGG - Intergenic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185695786 X:2193432-2193454 ATGGATAGACAGATACATGATGG - Intergenic
1187440599 X:19314858-19314880 ATTGTTAAATAGCTTGATTATGG - Intergenic
1188758920 X:34000830-34000852 ATGGATAAAGCGTTTGAGGAAGG - Intergenic
1196037009 X:111156382-111156404 ATGGATTGACTGCTTGATGAAGG + Intronic
1196310900 X:114163880-114163902 ATGGATAAAAGGCAAGATGAAGG - Intergenic
1196963360 X:121027961-121027983 ATGGATAATCTGCTTCATAAGGG - Intergenic
1199118369 X:144019797-144019819 AGAGATAAACAGCTTGGTAAGGG - Intergenic
1200568003 Y:4792130-4792152 ATGCATTAACAGCTGGGTGATGG + Intergenic
1200952572 Y:8914575-8914597 ATGGGTTAACAGCTTGTGGAAGG - Intergenic
1201016784 Y:9612047-9612069 ATGGGTTAACAGCTTGTGGAAGG + Intergenic
1201151183 Y:11096491-11096513 ATGGATAAACAGTTTACAGATGG + Intergenic