ID: 1099171161

View in Genome Browser
Species Human (GRCh38)
Location 12:79366443-79366465
Sequence CCCTGACCTTGCCAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099171156_1099171161 20 Left 1099171156 12:79366400-79366422 CCTCCCATCAGGAATTTAACTTT 0: 1
1: 0
2: 0
3: 11
4: 222
Right 1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 216
1099171157_1099171161 17 Left 1099171157 12:79366403-79366425 CCCATCAGGAATTTAACTTTATA 0: 1
1: 0
2: 2
3: 16
4: 267
Right 1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 216
1099171158_1099171161 16 Left 1099171158 12:79366404-79366426 CCATCAGGAATTTAACTTTATAG 0: 1
1: 0
2: 1
3: 21
4: 207
Right 1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 216
1099171155_1099171161 29 Left 1099171155 12:79366391-79366413 CCTTAAAAGCCTCCCATCAGGAA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099171161 Original CRISPR CCCTGACCTTGCCAAGAGGC AGG Intronic
900990483 1:6096189-6096211 CCCTGACCTTGCCATGGGATGGG - Intronic
901588698 1:10320647-10320669 CCTTGAGATTGCCAAGAGGTTGG - Intronic
901957521 1:12797349-12797371 TCATGACCCTGCCAAGAGGGGGG - Intergenic
902239757 1:15080726-15080748 CCCTGCCCTTGGGAAGTGGCAGG - Intronic
902575583 1:17375196-17375218 CCCTAACCTTGTCGAGAGCCAGG - Intronic
902710232 1:18234279-18234301 CCCTGGCCTTCCAAAGAGCCAGG + Intronic
902950003 1:19874891-19874913 ACCTCAGCTTCCCAAGAGGCTGG - Intergenic
903242157 1:21990283-21990305 CCCTGAACTTGCCACAAGGCAGG - Intronic
903245667 1:22013470-22013492 CCCTGAACTTGCCACAAGGCAGG - Intergenic
904030243 1:27528962-27528984 CCCTGTCCTTGCCAGGTGGGGGG - Intergenic
906874929 1:49527247-49527269 CCCTGACCTTACCAAGTGGCAGG + Intronic
907286298 1:53382546-53382568 CCCTGATGCTGCCCAGAGGCTGG + Intergenic
908259608 1:62329444-62329466 GCCTCACCTTCCCAAGAAGCTGG - Intergenic
909761148 1:79288965-79288987 CCCTGACCTTACCCTGAAGCAGG + Intergenic
912951071 1:114120960-114120982 CGCTGTCCGTGCCTAGAGGCAGG + Intronic
915118909 1:153616475-153616497 CCATGACCCTGCCACGAGGAGGG + Intronic
915319086 1:155046344-155046366 CCCTCACCTGGCCAAGGAGCAGG - Exonic
918559527 1:185847836-185847858 CCCTCACCTTTCCAAGTAGCTGG - Intronic
919426270 1:197435354-197435376 CCCTGACCATCCCAAGGGACAGG - Exonic
920043124 1:203116660-203116682 CCCTGACAGTGCCAAAGGGCTGG - Intronic
920308105 1:205031780-205031802 ACCTGACCTGGCGGAGAGGCGGG - Intergenic
920865368 1:209747916-209747938 CCCTGAACTGACCTAGAGGCGGG + Intergenic
921851647 1:219938375-219938397 CCCTGACTTTTCCCAGAGGCAGG + Intronic
922730656 1:227947450-227947472 CCGTGTCCTTGCCAAAAGGCTGG - Intronic
923028534 1:230226645-230226667 CCTTGACCTGGCTCAGAGGCAGG + Intronic
1063187368 10:3663597-3663619 GCCTGGCCTTTCCCAGAGGCAGG - Intergenic
1063187391 10:3663691-3663713 GCCTGGCCTTTCCCAGAGGCAGG - Intergenic
1063187413 10:3663785-3663807 GCCTGGCCTTTCCCAGAGGCAGG - Intergenic
1063301559 10:4853916-4853938 CCCTGACATTGCCATGGCGCTGG - Intergenic
1067958478 10:50820097-50820119 CTCTCACCTTGCCAAGAGTAGGG - Intronic
1068549095 10:58385776-58385798 CCGCGACCTTGCCAAGGGGACGG + Intronic
1068549210 10:58386840-58386862 CCTCGACCTTGCCAAGGGGATGG + Intronic
1069115415 10:64499259-64499281 GTCTTACCTTGACAAGAGGCAGG + Intergenic
1071510828 10:86261587-86261609 CACTGACCTAACCAAGAGGTTGG - Intronic
1072095916 10:92179681-92179703 CCCTAACCCTGCCAAAAGGCAGG + Intronic
1073131980 10:101195524-101195546 CGCAGCCATTGCCAAGAGGCAGG - Intergenic
1074857740 10:117485871-117485893 CCCTCACTTTACAAAGAGGCAGG + Intergenic
1075679313 10:124321209-124321231 ACGTGACCTTCCCAGGAGGCAGG + Intergenic
1076884255 10:133254404-133254426 CCCAGACCCTGCCAGGAGCCAGG - Intergenic
1077230245 11:1455398-1455420 GCCTGATCTTGCCAAGACCCTGG - Intronic
1077527678 11:3077351-3077373 CACTCACCTGGGCAAGAGGCTGG + Intergenic
1077667537 11:4127193-4127215 CTGTGACCTTGCCAAGGAGCAGG + Exonic
1083826374 11:65206356-65206378 CCTTGTCCTGGCCAAGGGGCTGG - Intronic
1089173800 11:116534298-116534320 CCCTGGCCTTCAAAAGAGGCAGG + Intergenic
1090867008 11:130709929-130709951 CCCTGACCTTCCCAAGGCACAGG - Intronic
1091585005 12:1811097-1811119 CCCTGCCCTTGCCCAGAGTCAGG + Intronic
1091592097 12:1848855-1848877 GCCTGAGCCTGCCATGAGGCTGG + Intronic
1092384552 12:8026234-8026256 CCCTGTCCTTGTCTAAAGGCAGG + Intergenic
1092526480 12:9312942-9312964 CCCTGTCCTGGCCAAGCTGCCGG + Intergenic
1092540796 12:9418840-9418862 CCCTGTCCTGGCCAAGCTGCCGG - Intergenic
1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG + Exonic
1097746450 12:63309262-63309284 CCCTCAACTTCCCAACAGGCCGG + Intergenic
1098930726 12:76409241-76409263 CTCTGACCTTGCCCTGAAGCAGG + Intronic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1101801874 12:108029434-108029456 CTCCGACCTTGGCAGGAGGCAGG + Intergenic
1101901472 12:108794130-108794152 CCCAAACTTGGCCAAGAGGCTGG + Intronic
1103039039 12:117679537-117679559 CACAGACCTGGCCATGAGGCAGG + Intronic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1105899460 13:24742920-24742942 CACTGACTTTGGCAAGAGGGTGG + Intergenic
1106249456 13:27972523-27972545 CCCTGCCCTTGCCACCAGCCAGG - Intergenic
1112814114 13:103252013-103252035 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1113297899 13:108982229-108982251 ACCTGCTCTTGCCATGAGGCAGG + Intronic
1117043460 14:51788994-51789016 GCCTCACCTTCCCAAGTGGCTGG - Intergenic
1118607387 14:67514352-67514374 CCCTGCCCTTGCCAGGAACCGGG + Intronic
1119904142 14:78286186-78286208 CCCTGACCCTGCCAAATGGGCGG + Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1128162913 15:65436165-65436187 CCCTGAACTTGCCCAGAGAAAGG - Intergenic
1128762535 15:70227197-70227219 CTCTGCCCTTGACAGGAGGCAGG - Intergenic
1130169555 15:81497494-81497516 CCCTGGGCTTTCCAGGAGGCTGG + Intergenic
1130194288 15:81764499-81764521 CCATGACATTGCTAAGAGCCAGG - Intergenic
1130758246 15:86789518-86789540 CCCTTAGCTTTCCAAGAGGGTGG - Intronic
1130943308 15:88530061-88530083 CCCTGACCTTGCCCACATGCTGG - Intronic
1131818220 15:96245051-96245073 CCCAGACCTTGAAAAGAGGCTGG + Intergenic
1131906324 15:97147086-97147108 GTCTGAGCTTGTCAAGAGGCAGG + Intergenic
1132120921 15:99174666-99174688 CCCTGACAGTGCCTGGAGGCCGG + Intronic
1132737231 16:1392968-1392990 CCCTGTCCTTGCAGAGAGCCTGG - Intronic
1133590986 16:7243263-7243285 CCCTGACCACGCCTATAGGCTGG - Intronic
1133744219 16:8674826-8674848 CCCTCATCTTCCCAAGACGCGGG + Intronic
1134506723 16:14813748-14813770 CCCTGACCTGGCCACGTGGGTGG - Intronic
1134573833 16:15315073-15315095 CCCTGACCTGGCCACGTGGGTGG + Intergenic
1134728585 16:16441245-16441267 CCCTGACCTGGCCACGTGGGTGG - Intergenic
1134938857 16:18270673-18270695 CCCTGACCTGGCCACGTGGGTGG + Intergenic
1136026823 16:27474032-27474054 CACTCACATTTCCAAGAGGCTGG + Intronic
1138128307 16:54456851-54456873 CCCTGCCCTTGCGATAAGGCAGG - Intergenic
1138337369 16:56263819-56263841 ACCTGACCTGTCCAAGAGGCTGG + Intronic
1138448929 16:57081431-57081453 CCCTGACCTTGGCCTGAGGAAGG + Intronic
1138528767 16:57623600-57623622 GCCTGGCCTAGCCAAGATGCGGG - Intronic
1142001804 16:87668570-87668592 ACCTGTCCTTGCCAAGGGTCCGG + Intronic
1142204234 16:88775152-88775174 CCCTGACCCTGACAGGACGCAGG + Intronic
1142741743 17:1935513-1935535 ACCTGGCCTTGCCAAGGGCCTGG - Exonic
1144187752 17:12812082-12812104 CCCTGACCTTGGCACAAAGCAGG - Intronic
1145251943 17:21301560-21301582 CCCTGACCTTGCCCGATGGCTGG - Intronic
1146016992 17:29241588-29241610 CCCTGGCCTTGCCTCTAGGCCGG - Intergenic
1146063966 17:29621217-29621239 CCCTCACCTTGGCCAGAGGCAGG + Exonic
1146067705 17:29649499-29649521 CCCTCAGCTTTCCAAGAAGCTGG + Intronic
1146563036 17:33888217-33888239 CCCTGACCTCCCCAATAAGCTGG - Intronic
1146667543 17:34715174-34715196 CCCTGACCTGCCCCAGAGGCTGG + Intergenic
1146920061 17:36704247-36704269 GCCTGACCCTGCCAAGAGAGGGG + Intergenic
1147313204 17:39606875-39606897 CCCTGACCCTGAGAAGAAGCAGG - Intronic
1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1147740807 17:42670130-42670152 CCCGGGCCTGGCCAAGAGGCGGG - Exonic
1148350503 17:46938616-46938638 CCTTGACATTGCCAACATGCTGG + Exonic
1148711162 17:49682068-49682090 CCCAAACCTCGTCAAGAGGCTGG - Intergenic
1149545512 17:57500621-57500643 CCCTGACCTTCAGAAGAGACAGG - Intronic
1150220600 17:63493791-63493813 CCCAGACCATCCCAGGAGGCAGG + Intronic
1151020943 17:70616805-70616827 CCCTGACCTTGAGCAGAGGAGGG - Intergenic
1151491838 17:74436352-74436374 CCCAGACACTGCCAAGAGACAGG - Intronic
1151724545 17:75876620-75876642 CCCTGACCTGGCCCAGATCCAGG - Intronic
1152689070 17:81709462-81709484 GCCTCACCTTCCCAAGAAGCTGG + Intergenic
1154350696 18:13580702-13580724 CCGTGCCCTTGTCCAGAGGCAGG + Intronic
1157152382 18:45231040-45231062 CCTTGACATTTCCAGGAGGCTGG - Intronic
1161029024 19:2049494-2049516 CCCTGGCCATGCACAGAGGCCGG + Intronic
1161493469 19:4575329-4575351 CTCTGCCCCTCCCAAGAGGCTGG + Intergenic
1161514553 19:4689402-4689424 CCCTGCCCTACCCAGGAGGCAGG + Intronic
1161557766 19:4954260-4954282 CCCAGACCTGGCAAGGAGGCTGG + Intronic
1162106611 19:8373690-8373712 CCCTGACCCCGGCAGGAGGCTGG + Exonic
1164552163 19:29220927-29220949 CCCCCATCTTGCCAGGAGGCTGG - Intergenic
1165389321 19:35529354-35529376 CCCTGCCCTTGCCCAAGGGCTGG - Intergenic
1167016410 19:46843777-46843799 ACCTCAGCTTGCCAAGTGGCTGG - Intronic
925033730 2:671312-671334 CCCTGACCTTGTCCAGAGGCTGG - Intronic
926327997 2:11801976-11801998 CTCTAACCTTGCCTAGAGGAAGG + Intronic
926707341 2:15846083-15846105 CCCTGACCCAGGCAAGGGGCTGG - Intergenic
927647352 2:24886460-24886482 CCCGGACCTTGCAAAGGGCCAGG + Intronic
927729947 2:25462366-25462388 CCCTGACCTTGTCCTGAGGCTGG + Intronic
927946348 2:27137405-27137427 CCCTGGCCTGGCCCTGAGGCAGG + Exonic
927948087 2:27149340-27149362 TCCTTACCCTGCCAAGAGCCAGG - Exonic
929045520 2:37785238-37785260 CCCTGAACTTGCCCACAGACAGG - Intergenic
929579589 2:43073342-43073364 CTCTTACTTTGCCAAGAGGGAGG - Intergenic
930498911 2:52185719-52185741 CACTGACCTGGCACAGAGGCAGG - Intergenic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
935268876 2:101416594-101416616 CCCTGACCTGGCAAGGAGGGTGG + Intronic
937071007 2:119063135-119063157 CCCTGTCCTGACCAAGAGACAGG + Intergenic
937322260 2:120967925-120967947 CCCAGACATTGCGAAGAGTCTGG + Intronic
937820739 2:126307951-126307973 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
938030261 2:127986142-127986164 CTCTGTCCTTGCCATAAGGCAGG + Intronic
940195832 2:151093061-151093083 CCCTGACCTTTTCATGAGGATGG + Intergenic
944838531 2:203603318-203603340 CACTGACCCTGCCAAGACTCAGG + Intergenic
947665983 2:231905497-231905519 CACGGGCCTTTCCAAGAGGCAGG - Intergenic
947834068 2:233162886-233162908 CCCTGACCATGTCCAGAGGGAGG - Intronic
948129557 2:235590502-235590524 CCGTGACCATGCCCAGAGACAGG + Intronic
948190570 2:236055074-236055096 CCCGGACCTTGACAAGCGGGAGG - Intronic
948846470 2:240685133-240685155 CCCTGAACTTCCCCAGAGGGAGG + Intergenic
948847392 2:240689600-240689622 CCCTGAACTTCCCCAGAGGGAGG - Intergenic
1170471729 20:16674628-16674650 CCCAGACCTGGCCACGTGGCCGG - Intergenic
1171079002 20:22158625-22158647 CCCTGACCATGTCCAGAGGCTGG + Intergenic
1172021818 20:31919970-31919992 CTCTGACCTTGCCAGCAGGAGGG + Intronic
1172352647 20:34255408-34255430 ACCTCACCCTCCCAAGAGGCTGG + Intronic
1172515688 20:35531278-35531300 ACCTCAGCTTGCCAAGATGCTGG + Intergenic
1173408138 20:42785230-42785252 CCCCGGCCTTGCCAAAAGTCTGG + Intronic
1175056370 20:56202387-56202409 CCCTGATCTAGCCCAGGGGCTGG - Intergenic
1175139088 20:56846568-56846590 CCCAGATCTTTCCAGGAGGCAGG - Intergenic
1175461240 20:59153344-59153366 CCCTGACCTTCTCAAAAGTCAGG - Intergenic
1175674002 20:60931529-60931551 CCCTGACCTGGCCCTCAGGCTGG - Intergenic
1175987842 20:62772793-62772815 CACTCACCTTGCCACTAGGCAGG + Intergenic
1175994674 20:62806774-62806796 CCCTGACCTTGTGATGAGGGTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177610825 21:23445671-23445693 CACTGCCCTTGCCAAGAGGAAGG + Intergenic
1179629090 21:42665749-42665771 CCCTGCCCCTGCCCAGAGACTGG + Intronic
1179826184 21:43967887-43967909 CCCTGACCATCCCAGGAGGAGGG + Intronic
1181047751 22:20223655-20223677 CCCTGACCTGCCCCAGGGGCTGG - Intergenic
1181548116 22:23616452-23616474 CCCTAACCCTGCCAAGCAGCAGG + Intronic
1182880363 22:33727838-33727860 CCCTGACCTTTCCAAGCCTCAGG - Intronic
1183479769 22:38057161-38057183 CCCTGCCCTTCCCAAGATGGCGG + Intronic
1183906145 22:41041774-41041796 CCCTCACCTTCCCAAGTCGCTGG + Intergenic
1184225924 22:43128863-43128885 CCCTGCCCTGGCCAGGAGACGGG - Intronic
1184600101 22:45538400-45538422 CATGGACCCTGCCAAGAGGCGGG - Intronic
950520766 3:13496543-13496565 CCCAGAGCTTGCCAGGAGCCTGG + Intronic
951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG + Intronic
951559820 3:23954581-23954603 CCCTCACTGTGACAAGAGGCAGG - Exonic
952298760 3:32085509-32085531 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
956705656 3:71996702-71996724 CTCTGACCTTTCCCTGAGGCAGG + Intergenic
958048567 3:88317161-88317183 CTCTGACCTGGCCAAGAAGAAGG + Intergenic
959056988 3:101576779-101576801 CACTGACCTCACCAAGAGGGCGG - Intronic
959999090 3:112712192-112712214 CCTTGACATTGCTGAGAGGCTGG - Intergenic
962714656 3:138115782-138115804 TCCTGGCCTTGCTGAGAGGCTGG + Intronic
967282207 3:187833432-187833454 ACCTGAGCCTCCCAAGAGGCTGG - Intergenic
967286042 3:187871526-187871548 CCTTGACCTTAACCAGAGGCAGG + Intergenic
968704545 4:2071880-2071902 CCCTGCCCCGGCCAAGTGGCTGG + Intergenic
968729965 4:2264984-2265006 CCCTGCCCTTCCCCAGAGCCAGG + Intergenic
968880577 4:3296768-3296790 CCCTGCCCTTGGGGAGAGGCGGG + Intronic
969713091 4:8855600-8855622 CCTTGACCTTGCTAAGTGCCAGG - Intronic
970225492 4:13852441-13852463 ACAGGACCTTGTCAAGAGGCTGG + Intergenic
971635458 4:29051535-29051557 GGCTGACCTTCCTAAGAGGCTGG - Intergenic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
974850257 4:67395772-67395794 CTCTGACCTTCCCATGAAGCAGG + Intergenic
975208949 4:71676863-71676885 CTCTAGCCTTGCCACGAGGCTGG - Intergenic
975900512 4:79146407-79146429 CCCTACCCTTGCTAAGAAGCTGG - Intergenic
978503258 4:109432049-109432071 CTCTGACCTTCCCATGAAGCAGG - Intergenic
980604124 4:135066620-135066642 CCCAGAACTTGCCGAGATGCAGG - Intergenic
982198186 4:152936473-152936495 CCCTGACCCTCCCGAGCGGCGGG - Intronic
982841701 4:160195671-160195693 GCCTAAGCTTCCCAAGAGGCTGG + Intergenic
983253516 4:165372835-165372857 CCTTGGCCTTGCCAAGTGCCGGG + Intronic
989813952 5:45712602-45712624 CCCTCACCCTTCCAAGATGCTGG - Intergenic
991535028 5:67660351-67660373 TGCTGACCTTGCCAAGAGATAGG - Intergenic
995135065 5:108672044-108672066 CCCTTACCTTGACAACAGACCGG + Intergenic
996710681 5:126540352-126540374 CTCTCCCCTTGCCAAGGGGCAGG + Intergenic
997473030 5:134127269-134127291 CCCTGAACTTGCCAGGTGTCTGG - Intronic
997641258 5:135450281-135450303 CCCTTTCCTTTCCAAGAAGCAGG - Intronic
999450666 5:151675438-151675460 CTCTCACCTGGCCAAGAAGCTGG + Intronic
999759155 5:154687032-154687054 CTGTGATTTTGCCAAGAGGCAGG + Intergenic
1001282709 5:170398768-170398790 CCCTGCCCATGCTGAGAGGCTGG - Intronic
1005406894 6:25498983-25499005 CCCTGACCTTGTTAGGAGGCTGG - Intronic
1005755920 6:28924648-28924670 ACCTGGCCTCCCCAAGAGGCTGG + Intergenic
1006077778 6:31545452-31545474 CGCAGACCATGCCAAGAAGCTGG + Exonic
1012155510 6:95814785-95814807 CCCTCACCTTCCCGAGAGGTAGG + Intergenic
1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1016952541 6:149594231-149594253 CACTGACCTCACCAAGAGGGCGG + Intergenic
1018486805 6:164248974-164248996 CCCTGGCTGTGCCATGAGGCTGG + Intergenic
1020684335 7:11274753-11274775 CCATGACCTTCTCAAGAGGAAGG - Intergenic
1020960588 7:14797867-14797889 CCCAGAACTTGCCAAGCTGCGGG - Intronic
1021436828 7:20627802-20627824 CCATGACATTGCCATGATGCCGG + Intronic
1023833830 7:44057078-44057100 CTCTGACCTTGCCTAGGGGTTGG + Intronic
1024607598 7:51035073-51035095 CTCCGACCATCCCAAGAGGCTGG - Intronic
1026464812 7:70644904-70644926 CCTTGACCTCTCCAAGAGGCGGG + Intronic
1029479030 7:100801979-100802001 CCCTCCCCTTTCCAAGAGGCAGG + Intergenic
1030073878 7:105720388-105720410 CACTAACCTAGGCAAGAGGCAGG - Intronic
1034454066 7:151155642-151155664 CCCTGAACTTGTCATGAAGCTGG - Intronic
1035711004 8:1714103-1714125 GCCTGACCCTACCAAGAAGCTGG - Intergenic
1036399310 8:8394005-8394027 GCCTCAGCTTGCCAAGCGGCAGG - Intergenic
1037956458 8:23064144-23064166 CCATGAACTTGCAAAGAGTCTGG + Intronic
1039391596 8:37185338-37185360 CCCTGACCTTACCAAGAGCAGGG - Intergenic
1044247435 8:89965602-89965624 CCCTGAGCTTCCCAAGTAGCTGG + Intronic
1045507524 8:102789136-102789158 CCCTGACCTTCCCTTCAGGCTGG - Intergenic
1046254591 8:111679840-111679862 CCCTGACCTTACACAGAGACTGG + Intergenic
1047577267 8:126170904-126170926 CCTTTTCCTAGCCAAGAGGCAGG - Intergenic
1048845029 8:138597865-138597887 CACTGACTTGGCCAAGAGACAGG + Intronic
1049555819 8:143281475-143281497 CCCTGACCTGGCCCCGAGGGTGG + Intergenic
1049622468 8:143604858-143604880 CCCTGACCTAGGCACGGGGCAGG + Exonic
1049759166 8:144324159-144324181 GCCTCACCTTGCCACGGGGCCGG + Intronic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1052996655 9:34554779-34554801 CCTTGACCTTGGGGAGAGGCAGG - Intronic
1055404724 9:75962597-75962619 GCCTAACCTTGAAAAGAGGCAGG + Intronic
1058697169 9:107569327-107569349 CTCTGACCTTTCCACGGGGCAGG + Intergenic
1060558998 9:124527448-124527470 CCCTGACTTTGGCAGGAGGGAGG + Intronic
1061431489 9:130534044-130534066 CCCTGAGCTTCCCAAGTAGCTGG - Intergenic
1061541654 9:131280722-131280744 CACTGACCCTGCCAAGCTGCAGG + Intergenic
1061667141 9:132167156-132167178 TCCAGACCTGGTCAAGAGGCAGG - Intronic
1062087892 9:134658061-134658083 CCCTGACGGTGGCAAGAGACGGG - Intronic
1192748475 X:73963661-73963683 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1200224405 X:154409273-154409295 CCCCACCCTTGCCAACAGGCAGG + Intronic
1202196841 Y:22306267-22306289 CCCTTACCTGGCCAAGAAGGAGG + Intergenic