ID: 1099179531

View in Genome Browser
Species Human (GRCh38)
Location 12:79461178-79461200
Sequence GTGTAAACCCACTATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099179531_1099179534 4 Left 1099179531 12:79461178-79461200 CCATTATCATAGTGGGTTTACAC No data
Right 1099179534 12:79461205-79461227 TGATATTATTTATAACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099179531 Original CRISPR GTGTAAACCCACTATGATAA TGG (reversed) Intergenic
No off target data available for this crispr