ID: 1099182924

View in Genome Browser
Species Human (GRCh38)
Location 12:79488280-79488302
Sequence CTTAAAAAGTAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099182917_1099182924 0 Left 1099182917 12:79488257-79488279 CCAGTCCTATGGCCCTTAAAGAC No data
Right 1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG No data
1099182914_1099182924 12 Left 1099182914 12:79488245-79488267 CCCAATGACTTACCAGTCCTATG No data
Right 1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG No data
1099182915_1099182924 11 Left 1099182915 12:79488246-79488268 CCAATGACTTACCAGTCCTATGG No data
Right 1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG No data
1099182918_1099182924 -5 Left 1099182918 12:79488262-79488284 CCTATGGCCCTTAAAGACCTTAA No data
Right 1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099182924 Original CRISPR CTTAAAAAGTAGAAGGAGGC CGG Intergenic
No off target data available for this crispr