ID: 1099184437

View in Genome Browser
Species Human (GRCh38)
Location 12:79502635-79502657
Sequence TTGTTAACAGAAGCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099184437_1099184442 7 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184442 12:79502665-79502687 AAGCTTCCAATCATGGAGGACGG 0: 8
1: 209
2: 1093
3: 4847
4: 9256
1099184437_1099184447 14 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184447 12:79502672-79502694 CAATCATGGAGGACGGGGAAGGG No data
1099184437_1099184444 9 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184444 12:79502667-79502689 GCTTCCAATCATGGAGGACGGGG No data
1099184437_1099184443 8 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184443 12:79502666-79502688 AGCTTCCAATCATGGAGGACGGG No data
1099184437_1099184446 13 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG No data
1099184437_1099184448 15 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184448 12:79502673-79502695 AATCATGGAGGACGGGGAAGGGG No data
1099184437_1099184440 0 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184440 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 26
1: 468
2: 1702
3: 8489
4: 10105
1099184437_1099184441 3 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184441 12:79502661-79502683 CAAGAAGCTTCCAATCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099184437 Original CRISPR TTGTTAACAGAAGCAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr