ID: 1099184439

View in Genome Browser
Species Human (GRCh38)
Location 12:79502658-79502680
Sequence CCATGATTGGAAGCTTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20440
Summary {0: 25, 1: 456, 2: 1652, 3: 8228, 4: 10079}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099184439_1099184448 -8 Left 1099184439 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 25
1: 456
2: 1652
3: 8228
4: 10079
Right 1099184448 12:79502673-79502695 AATCATGGAGGACGGGGAAGGGG No data
1099184439_1099184449 8 Left 1099184439 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 25
1: 456
2: 1652
3: 8228
4: 10079
Right 1099184449 12:79502689-79502711 GAAGGGGAGCACATATTACATGG No data
1099184439_1099184446 -10 Left 1099184439 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 25
1: 456
2: 1652
3: 8228
4: 10079
Right 1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG No data
1099184439_1099184447 -9 Left 1099184439 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 25
1: 456
2: 1652
3: 8228
4: 10079
Right 1099184447 12:79502672-79502694 CAATCATGGAGGACGGGGAAGGG No data
1099184439_1099184450 20 Left 1099184439 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 25
1: 456
2: 1652
3: 8228
4: 10079
Right 1099184450 12:79502701-79502723 ATATTACATGGTGAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099184439 Original CRISPR CCATGATTGGAAGCTTCTTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr