ID: 1099184446

View in Genome Browser
Species Human (GRCh38)
Location 12:79502671-79502693
Sequence CCAATCATGGAGGACGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099184439_1099184446 -10 Left 1099184439 12:79502658-79502680 CCTCAAGAAGCTTCCAATCATGG 0: 25
1: 456
2: 1652
3: 8228
4: 10079
Right 1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG No data
1099184437_1099184446 13 Left 1099184437 12:79502635-79502657 CCAGCCTCTGCTTCTGTTAACAA No data
Right 1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG No data
1099184438_1099184446 9 Left 1099184438 12:79502639-79502661 CCTCTGCTTCTGTTAACAACCTC No data
Right 1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099184446 Original CRISPR CCAATCATGGAGGACGGGGA AGG Intergenic
No off target data available for this crispr