ID: 1099187836

View in Genome Browser
Species Human (GRCh38)
Location 12:79535095-79535117
Sequence GAGATGAGGTTTCACCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390544
Summary {0: 3388, 1: 48596, 2: 103978, 3: 132260, 4: 102322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099187836_1099187843 25 Left 1099187836 12:79535095-79535117 CCAACATGGTGAAACCTCATCTC 0: 3388
1: 48596
2: 103978
3: 132260
4: 102322
Right 1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG No data
1099187836_1099187840 8 Left 1099187836 12:79535095-79535117 CCAACATGGTGAAACCTCATCTC 0: 3388
1: 48596
2: 103978
3: 132260
4: 102322
Right 1099187840 12:79535126-79535148 ATACAAAAATTAGCTGGCCGTGG 0: 206
1: 18952
2: 70341
3: 96878
4: 124127
1099187836_1099187839 2 Left 1099187836 12:79535095-79535117 CCAACATGGTGAAACCTCATCTC 0: 3388
1: 48596
2: 103978
3: 132260
4: 102322
Right 1099187839 12:79535120-79535142 CTAAAAATACAAAAATTAGCTGG 0: 84164
1: 74614
2: 45566
3: 28364
4: 50515
1099187836_1099187841 11 Left 1099187836 12:79535095-79535117 CCAACATGGTGAAACCTCATCTC 0: 3388
1: 48596
2: 103978
3: 132260
4: 102322
Right 1099187841 12:79535129-79535151 CAAAAATTAGCTGGCCGTGGTGG 0: 215
1: 19009
2: 84997
3: 155081
4: 204316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099187836 Original CRISPR GAGATGAGGTTTCACCATGT TGG (reversed) Intergenic
Too many off-targets to display for this crispr