ID: 1099187837

View in Genome Browser
Species Human (GRCh38)
Location 12:79535109-79535131
Sequence TTGTATTTTTAGGAGAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 537680
Summary {0: 468, 1: 85102, 2: 173521, 3: 172086, 4: 106503}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099187837_1099187840 -6 Left 1099187837 12:79535109-79535131 CCTCATCTCTCCTAAAAATACAA 0: 468
1: 85102
2: 173521
3: 172086
4: 106503
Right 1099187840 12:79535126-79535148 ATACAAAAATTAGCTGGCCGTGG 0: 206
1: 18952
2: 70341
3: 96878
4: 124127
1099187837_1099187844 25 Left 1099187837 12:79535109-79535131 CCTCATCTCTCCTAAAAATACAA 0: 468
1: 85102
2: 173521
3: 172086
4: 106503
Right 1099187844 12:79535157-79535179 GCCTGTAGGCCCAGCTACTCAGG 0: 224
1: 73729
2: 193874
3: 239059
4: 178816
1099187837_1099187843 11 Left 1099187837 12:79535109-79535131 CCTCATCTCTCCTAAAAATACAA 0: 468
1: 85102
2: 173521
3: 172086
4: 106503
Right 1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG No data
1099187837_1099187841 -3 Left 1099187837 12:79535109-79535131 CCTCATCTCTCCTAAAAATACAA 0: 468
1: 85102
2: 173521
3: 172086
4: 106503
Right 1099187841 12:79535129-79535151 CAAAAATTAGCTGGCCGTGGTGG 0: 215
1: 19009
2: 84997
3: 155081
4: 204316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099187837 Original CRISPR TTGTATTTTTAGGAGAGATG AGG (reversed) Intergenic
Too many off-targets to display for this crispr