ID: 1099187838

View in Genome Browser
Species Human (GRCh38)
Location 12:79535119-79535141
Sequence CAGCTAATTTTTGTATTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8197
Summary {0: 794, 1: 1252, 2: 1827, 3: 1552, 4: 2772}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099187838_1099187843 1 Left 1099187838 12:79535119-79535141 CCTAAAAATACAAAAATTAGCTG 0: 794
1: 1252
2: 1827
3: 1552
4: 2772
Right 1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG No data
1099187838_1099187844 15 Left 1099187838 12:79535119-79535141 CCTAAAAATACAAAAATTAGCTG 0: 794
1: 1252
2: 1827
3: 1552
4: 2772
Right 1099187844 12:79535157-79535179 GCCTGTAGGCCCAGCTACTCAGG 0: 224
1: 73729
2: 193874
3: 239059
4: 178816
1099187838_1099187849 28 Left 1099187838 12:79535119-79535141 CCTAAAAATACAAAAATTAGCTG 0: 794
1: 1252
2: 1827
3: 1552
4: 2772
Right 1099187849 12:79535170-79535192 GCTACTCAGGAAGCTGAGGCAGG 0: 3177
1: 85803
2: 183745
3: 211993
4: 142434
1099187838_1099187847 24 Left 1099187838 12:79535119-79535141 CCTAAAAATACAAAAATTAGCTG 0: 794
1: 1252
2: 1827
3: 1552
4: 2772
Right 1099187847 12:79535166-79535188 CCCAGCTACTCAGGAAGCTGAGG 0: 4198
1: 102429
2: 207062
3: 237444
4: 151828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099187838 Original CRISPR CAGCTAATTTTTGTATTTTT AGG (reversed) Intergenic
Too many off-targets to display for this crispr