ID: 1099187843

View in Genome Browser
Species Human (GRCh38)
Location 12:79535143-79535165
Sequence CCGTGGTGGCATGTGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099187836_1099187843 25 Left 1099187836 12:79535095-79535117 CCAACATGGTGAAACCTCATCTC 0: 3388
1: 48596
2: 103978
3: 132260
4: 102322
Right 1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG No data
1099187838_1099187843 1 Left 1099187838 12:79535119-79535141 CCTAAAAATACAAAAATTAGCTG 0: 794
1: 1252
2: 1827
3: 1552
4: 2772
Right 1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG No data
1099187837_1099187843 11 Left 1099187837 12:79535109-79535131 CCTCATCTCTCCTAAAAATACAA 0: 468
1: 85102
2: 173521
3: 172086
4: 106503
Right 1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099187843 Original CRISPR CCGTGGTGGCATGTGCCTGT AGG Intergenic
No off target data available for this crispr