ID: 1099194409

View in Genome Browser
Species Human (GRCh38)
Location 12:79598201-79598223
Sequence CAGTGCAAACATCAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099194409 Original CRISPR CAGTGCAAACATCAGGAGGT AGG Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
903442800 1:23401137-23401159 CAGGCCAAACAGCAAGAGGTGGG - Intronic
903442933 1:23401814-23401836 CGGGCCACACATCAGGAGGTGGG + Intronic
903451551 1:23456924-23456946 CAGAACAAACATCAGAATGTGGG + Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
911665904 1:100551344-100551366 CAGTGTTAACATCATGTGGTAGG + Intergenic
912564530 1:110577040-110577062 AAGTGCAAAGATCCTGAGGTGGG - Intergenic
913220044 1:116652564-116652586 CTGGGCTAACATCAGGAGGTAGG + Intronic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918993115 1:191724036-191724058 TAGTGTAAATATCAGGAGATAGG + Intergenic
919427192 1:197447499-197447521 AGGTGTAAACACCAGGAGGTGGG + Intronic
919690882 1:200527413-200527435 CAGTGCTAACATCTGGGGGTTGG - Intergenic
919760334 1:201094125-201094147 AAGTGCAAACGTCCTGAGGTGGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
921680267 1:218022944-218022966 AAGTCCATACATCAGTAGGTAGG - Intergenic
922014380 1:221630237-221630259 AAGTGCAAATATCCTGAGGTAGG + Intergenic
922975298 1:229779033-229779055 CACTTCAAACACCAAGAGGTGGG - Intergenic
1062997007 10:1875283-1875305 CAGTAAAAAGATCAGGAGTTGGG - Intergenic
1063917325 10:10896666-10896688 CTCAGCAAACATCAGAAGGTAGG + Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065366825 10:24944998-24945020 CAGTGCAAAGCTCAGGAGGCAGG - Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1069806832 10:71131612-71131634 CCTTGCAGGCATCAGGAGGTAGG - Intergenic
1070539962 10:77408919-77408941 CAGTGCCCACATCAGAAGGTGGG + Intronic
1072387498 10:94946270-94946292 GAGTGCAAACATGTGGAGTTTGG - Intronic
1073767188 10:106695599-106695621 CAGTACATACATTATGAGGTAGG - Intronic
1075498223 10:122946841-122946863 GAGTGCAAAGGTCTGGAGGTGGG + Intronic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1077209372 11:1361555-1361577 TAGTGCAAAGAACAGGAAGTTGG + Intergenic
1077217607 11:1401543-1401565 CAGTGCAGCCTGCAGGAGGTGGG - Intronic
1078082209 11:8212211-8212233 CAATGCAGTCATCTGGAGGTAGG + Intergenic
1078915495 11:15774941-15774963 CAGTGGAAAAGTCATGAGGTGGG - Intergenic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079178812 11:18170096-18170118 CAGAGCAAGCCTCAGGAAGTAGG - Intronic
1079294714 11:19222595-19222617 GGGTGTAAACACCAGGAGGTGGG + Intergenic
1079459198 11:20665263-20665285 AAGTGCAAAGATCATGAGGATGG + Intergenic
1081717220 11:45259004-45259026 AAGTGAAAACATCTGGAGGCTGG - Intronic
1085812086 11:79692753-79692775 CAATAAAAACCTCAGGAGGTTGG + Intergenic
1086960028 11:92971888-92971910 TAGCGGACACATCAGGAGGTAGG - Intronic
1087049658 11:93872636-93872658 AAGTCCATACATCAGTAGGTGGG + Intergenic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1089397396 11:118145343-118145365 CAGTGCCAACCTCGGGAGGATGG + Intronic
1091922188 12:4314019-4314041 GAATGCAAAGATCCGGAGGTAGG + Intergenic
1092625478 12:10322554-10322576 CAGTCCAAACAACAGCAGGTGGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093338194 12:17936031-17936053 CAGTAAAAACATCACGAGCTAGG - Intergenic
1095854805 12:46848874-46848896 AAGTCCATACATCAGTAGGTGGG + Intergenic
1095893558 12:47258088-47258110 CTCTGCCAACATGAGGAGGTGGG + Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099194409 12:79598201-79598223 CAGTGCAAACATCAGGAGGTAGG + Intronic
1099246931 12:80203203-80203225 CTGGGCTAACATCAAGAGGTTGG + Intergenic
1099993931 12:89756197-89756219 CAGTGCAAAAATCCTTAGGTAGG + Intergenic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102761123 12:115386159-115386181 TAGTGCAAATGTCATGAGGTTGG - Intergenic
1102762868 12:115404162-115404184 TAGTGCAAAGGTCACGAGGTTGG + Intergenic
1102807456 12:115794470-115794492 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103058790 12:117842434-117842456 CAGTGAAAACATCAGCAGATAGG + Intronic
1104508340 12:129353610-129353632 AAGTGCAATCATCAGGAGAAAGG + Intronic
1105621962 13:22076685-22076707 CAGGGCTAAGATCAGGAGTTAGG + Intergenic
1106007746 13:25787115-25787137 CAGTGCCATCACCAGGAAGTGGG + Intronic
1106010559 13:25817055-25817077 CTGTTCCAACACCAGGAGGTTGG + Intronic
1106915817 13:34513051-34513073 AAGTGCAAACAACAGAATGTTGG - Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1125327651 15:38553256-38553278 AAGTTCTAACATCAGCAGGTGGG + Intronic
1128147404 15:65339611-65339633 CTGAGCAAACATGAGGAAGTGGG + Intronic
1129032593 15:72629604-72629626 GCGGGCAAACATCAGGAGGTGGG + Intergenic
1129217300 15:74107640-74107662 GCGGGCAAACATCAGGAGGTGGG - Intronic
1129407366 15:75328424-75328446 GCGGGCAAACATCAGGAGGTAGG + Intergenic
1129470545 15:75751216-75751238 GTGGGCAAACATCAGGAGGTGGG + Intergenic
1129734452 15:77951922-77951944 GTGGGCAAACATCAGGAGGTGGG - Intergenic
1129841137 15:78744069-78744091 GTGGGCAAACATCAGGAAGTGGG + Intergenic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1130159014 15:81380435-81380457 CACTGCAAACATGAGGGAGTAGG + Intergenic
1133472594 16:6089989-6090011 CTGGGCTAACATCACGAGGTAGG + Intronic
1134739364 16:16529122-16529144 CAGTGCAAAGGTCCTGAGGTGGG + Intergenic
1134928136 16:18183029-18183051 CAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1136265494 16:29115144-29115166 AAGTGCACACATCAGAAGGAAGG - Intergenic
1137412145 16:48237845-48237867 CAATGCAAAGATTAGGGGGTGGG - Intronic
1137537679 16:49339880-49339902 TAGTGCAAACATCCTAAGGTAGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137789206 16:51160598-51160620 AAGTGCAAAGATCCTGAGGTGGG + Intergenic
1139667416 16:68467391-68467413 CTGGTCAAATATCAGGAGGTAGG - Intergenic
1143256763 17:5563223-5563245 TAGTGCACACATCTGGAGATAGG - Intronic
1144197565 17:12909653-12909675 AAGTGCAGAGATAAGGAGGTAGG + Intronic
1144255713 17:13465076-13465098 CGGTGGAGACATTAGGAGGTGGG + Intergenic
1145421250 17:22833438-22833460 GAATGCAAACATCAGGAAGAAGG - Intergenic
1145454970 17:23305006-23305028 CAATGCAAACATCACGAAGAGGG - Intergenic
1145523870 17:24306974-24306996 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145530911 17:24409599-24409621 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145586696 17:25220588-25220610 GAATGCAAACATCACGAAGTAGG - Intergenic
1145589826 17:25265890-25265912 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145618311 17:25681765-25681787 CAATGCAAACATCACGAAGAGGG - Intergenic
1145621298 17:25725273-25725295 GAATGCAAACATCAGGAAGAGGG - Intergenic
1145623642 17:25759309-25759331 GAATGCAAACATCACGAGGACGG - Intergenic
1145635109 17:25925307-25925329 GAATGCAAACATCACGAAGTAGG - Intergenic
1145637245 17:25956199-25956221 CAATGCAAACATCACGAAGAGGG - Intergenic
1145653429 17:26191206-26191228 CAATGCAAACATCACGAAGAGGG - Intergenic
1145672854 17:26473624-26473646 CAATGCAAACATCACGAAGAGGG - Intergenic
1145677103 17:26535752-26535774 CAATGCAAACATCACGAAGAGGG - Intergenic
1145678979 17:26562911-26562933 GAATGCAAACATCACGAAGTAGG - Intergenic
1148337068 17:46849112-46849134 CAGTTCTAACATCAGGAGGAGGG + Intronic
1148650167 17:49244741-49244763 GGGTGCAGACATCAGGAGGTGGG - Intergenic
1150509610 17:65736581-65736603 CAGTGCAAAAAAGAGGAGATGGG + Intronic
1153953238 18:10074641-10074663 CAGTGCAAACATCACTGGGGTGG + Intergenic
1156047451 18:32892971-32892993 CAGTTAAAATATCACGAGGTTGG - Intergenic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1158274339 18:55750195-55750217 CAATTCAAACATCAGAAGGGTGG - Intergenic
1158480467 18:57817274-57817296 CAGGGCCAACATCAGGGAGTGGG + Intergenic
1159396679 18:67866833-67866855 CAGTGCAAAACACAAGAGGTAGG - Intergenic
1160222296 18:76986022-76986044 CACTGCAAACATGGGGAGGAAGG + Intronic
1161590781 19:5128255-5128277 CAGTGCACACATGAGGAATTGGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162937603 19:13989178-13989200 GAGTGCAAAGGTCAGGAGGCAGG + Intronic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1163000798 19:14365535-14365557 GAGTGCAGACATCAGGAGGTGGG - Intergenic
1164902984 19:31943878-31943900 CACTGCAAACATCATAAGTTAGG - Intergenic
1164940945 19:32251940-32251962 CAGTGCCGACATCAGCAGGAGGG + Intergenic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166999609 19:46738138-46738160 CAGTGCGAGCATCAGAGGGTGGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
926752780 2:16211545-16211567 CATTCCAAACATCAGGATGGAGG - Intergenic
929157967 2:38804728-38804750 AAGTGCAAACATCACAAGGTGGG - Intronic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
930409990 2:51013265-51013287 CAGGGCAAACATAAGCATGTGGG + Intronic
931240820 2:60450804-60450826 CAGTGCACACATCTGTTGGTAGG + Intergenic
931874634 2:66498525-66498547 CAGTGCTAACAGGAGGAGCTGGG + Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934855353 2:97725855-97725877 AAGTGCAAAGATCAGGAGGCAGG + Intronic
935584332 2:104787056-104787078 CAGTGGAAACATCAGGTTGTGGG - Intergenic
937254612 2:120546368-120546390 CAGTGCAGACATCTGGAGCCAGG - Intergenic
939614105 2:144343228-144343250 CATTGCAAAAATCAAGAGGATGG + Intergenic
939855545 2:147354560-147354582 CAGTGCAAACATGGGTCGGTAGG + Intergenic
940971510 2:159901607-159901629 CAGTGGAAAAAGCAGGAGTTAGG + Intronic
941623164 2:167801525-167801547 TAGTGCAAACATCAGGGCCTGGG - Intergenic
942151980 2:173085404-173085426 AAGTGGAAACATAAGAAGGTAGG - Intronic
942816227 2:180057321-180057343 CATTTCAAACATGATGAGGTAGG + Intergenic
942920668 2:181369849-181369871 CAGTCCAAACATCAGGAAGAAGG + Intergenic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946900025 2:224363469-224363491 CAAGGCAAAAATCAGGATGTTGG + Intergenic
948181966 2:235989400-235989422 AGGTGAAAACATCAGGAGGAGGG + Intronic
948516471 2:238506918-238506940 AAGTGCAAACGTCTGGGGGTGGG - Intergenic
948887656 2:240892189-240892211 CAGGGCCATCGTCAGGAGGTAGG - Intronic
1169153033 20:3305536-3305558 CAGTGCAAAGCTCTGGAGGCTGG + Intronic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1172018968 20:31899304-31899326 CATTCCAAACAGCAGGAGGTAGG + Intronic
1173314093 20:41927963-41927985 CAGTGCAAACATGTGGAGGCAGG - Intergenic
1174420165 20:50394237-50394259 GAGTGGAAACGTCAAGAGGTCGG + Intergenic
1174751600 20:53116661-53116683 CACTGGAGAAATCAGGAGGTAGG - Intronic
1175523501 20:59618148-59618170 CAGTGCAAAGGCCAGGTGGTGGG + Intronic
1177905069 21:26965238-26965260 CAGCGCTGATATCAGGAGGTAGG - Intronic
1178875542 21:36411484-36411506 CACAGCAAACACCAGGCGGTAGG - Exonic
1180010192 21:45044283-45044305 CAGTGAGAACACCAAGAGGTGGG + Intergenic
1180051667 21:45334458-45334480 TAGTGAAGACAGCAGGAGGTGGG - Intergenic
1180821341 22:18830585-18830607 CTGAGCTAACATCAGGAGGTAGG + Intergenic
1181191637 22:21145460-21145482 CTGAGCTAACATCAGGAGGTAGG - Intergenic
1181207560 22:21265050-21265072 CTGAGCTAACATCAGGAGGTAGG + Intergenic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181363104 22:22353985-22354007 CAGTGGAAATGTCAGGAGATGGG + Intergenic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1182979598 22:34656382-34656404 GAGTGGGAACATCAGGATGTTGG + Intergenic
1183019173 22:35013580-35013602 CAGTGCCATCGTCTGGAGGTAGG + Intergenic
1183022005 22:35034868-35034890 CAGTGCAAAGATCCGGAGGCAGG + Intergenic
1183819513 22:40334027-40334049 CAGTGCCCAAATCAGAAGGTGGG - Exonic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1203219359 22_KI270731v1_random:30366-30388 CTGAGCTAACATCAGGAGGTAGG - Intergenic
1203271466 22_KI270734v1_random:56461-56483 CTGAGCTAACATCAGGAGGTAGG + Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
950892013 3:16412611-16412633 AAGTGTGAACACCAGGAGGTGGG - Intronic
951058848 3:18180421-18180443 CAGTGCATATATCATGAGGAAGG - Intronic
953718218 3:45333844-45333866 GAGTCCATACATCAGAAGGTAGG + Intergenic
954818575 3:53304407-53304429 CAGAGCAAACATTTTGAGGTTGG - Intronic
956444114 3:69308786-69308808 CAGTGCAAAAGTCCTGAGGTGGG - Intronic
959105288 3:102058526-102058548 CAGTGCCAAAATCCTGAGGTGGG + Intergenic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
961159680 3:124713114-124713136 CAGTTCCAAGATCAGGATGTAGG - Intronic
962993964 3:140606277-140606299 TAGTGCAGTCATCTGGAGGTGGG - Intergenic
963800925 3:149675506-149675528 AAGTTCAAAAATCAGGAGGCTGG - Intronic
965114383 3:164469240-164469262 AAGTTCATACATCAGTAGGTAGG - Intergenic
965696452 3:171413471-171413493 CAGTGCAAAGATGCAGAGGTGGG - Intronic
966252782 3:177885455-177885477 CAGTGGATACATTAGGAGGTAGG - Intergenic
966462881 3:180197212-180197234 CAGTGGCAGCATCAAGAGGTGGG + Intergenic
967902334 3:194468001-194468023 CTGTGCAAATATCAGGAATTGGG - Intronic
969446491 4:7247752-7247774 CAGTTCAAAGATGAGGAGCTGGG - Intronic
969475819 4:7421981-7422003 CAGTTCACAGATGAGGAGGTGGG - Intronic
970895708 4:21101120-21101142 CACTGGAAACTTCAGTAGGTGGG - Intronic
970911281 4:21278951-21278973 GAGTGAAAACATCAGGAGGTTGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971366137 4:25978538-25978560 AAGTGGAAAGATGAGGAGGTAGG - Intergenic
972175828 4:36404792-36404814 CAGTGTAAAAATCAGCAGCTGGG - Intergenic
974077638 4:57182221-57182243 CAGTGGTAACATCAGTTGGTGGG + Intergenic
974818174 4:67032980-67033002 CAGTGCACACACCAGGGGCTCGG + Intergenic
976941559 4:90707760-90707782 GAGTGCAAATACAAGGAGGTAGG + Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982957627 4:161792124-161792146 CAGAGCAGACACCAGGAGTTGGG - Intronic
984007929 4:174336052-174336074 CACTGCTAACATCACGAAGTAGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
988015028 5:25545052-25545074 CAATGGAAACATCAGAACGTGGG - Intergenic
988017771 5:25581421-25581443 CAGTGAGAACATCAGCAGATGGG - Intergenic
988417735 5:30967446-30967468 AAGTCCATACATCAGGAGGCAGG + Intergenic
990353572 5:54942266-54942288 AATTGCAAGCAGCAGGAGGTGGG - Intergenic
993018717 5:82564837-82564859 CAGTGCAATCAACAGGATGGGGG - Intergenic
993298788 5:86180704-86180726 AACTGGAAACCTCAGGAGGTAGG + Intergenic
994141424 5:96345981-96346003 CAGTGTGAACATCAGAAGGCAGG + Intergenic
994383661 5:99102261-99102283 GGGTGTAAACACCAGGAGGTGGG - Intergenic
996486692 5:124043357-124043379 GAATGCAAACACCAGGAGGTGGG - Intergenic
997018485 5:129966319-129966341 CAGTGCACAGCTCAGCAGGTAGG + Intronic
1000528597 5:162389597-162389619 CATTGCATACATCTGGGGGTGGG - Intergenic
1001102222 5:168823800-168823822 CACTGCAAAGCTCTGGAGGTGGG + Intronic
1001411291 5:171514323-171514345 AAGTGCAAAGATCTGGATGTAGG + Intergenic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1002068714 5:176665696-176665718 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003455524 6:6278404-6278426 CAGTGCAAATATCAGGGGACAGG + Intronic
1003978931 6:11371031-11371053 CAGTGCAAACGTCCGGTGTTGGG + Intronic
1004074593 6:12333471-12333493 CAGTGCAAACTTTTGAAGGTAGG - Intergenic
1004638818 6:17494406-17494428 CACTACAAAGATCATGAGGTAGG - Intronic
1005529678 6:26690133-26690155 GAGTGCAAAGATCATGAGGAAGG - Intergenic
1005541118 6:26811514-26811536 GAGTGCAAAGATCATGAGGAAGG + Intergenic
1006513127 6:34532315-34532337 CAGTGCAGTAATCAGGAGGTGGG + Intronic
1007192276 6:40029692-40029714 CCATGCAGACATCAGGAGTTAGG + Intergenic
1008651007 6:53562714-53562736 AAGTCCATACATCAGTAGGTAGG - Intronic
1009011930 6:57853599-57853621 GAGTGCAAAGATCATGAGGAAGG + Intergenic
1013171095 6:107636722-107636744 GAGTGCAAACTCCAGGAGGAAGG + Intronic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013301059 6:108805297-108805319 GCGTGCAAACACCAGGAGGCAGG + Intergenic
1016095748 6:140034424-140034446 CAGAGAAAATATCATGAGGTAGG + Intergenic
1016417298 6:143846176-143846198 CAGTGCACACAACAGGAGAGAGG + Exonic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017386114 6:153885641-153885663 AAGTCCATACATCAGCAGGTAGG + Intergenic
1017503417 6:155046110-155046132 CAGCCCAAACCTCGGGAGGTGGG - Intronic
1018080687 6:160257236-160257258 CAATGCAGGCACCAGGAGGTTGG + Intronic
1021291028 7:18845936-18845958 CATAGCAAACCTCAGGAGCTGGG + Intronic
1023272490 7:38479608-38479630 CAGTGCAAAGGAAAGGAGGTGGG + Intronic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1024941755 7:54769807-54769829 TAGTGGAAACCTCAGGAGGGTGG + Intergenic
1026224359 7:68427601-68427623 CAGTGCATACATCCTGCGGTGGG + Intergenic
1029936449 7:104429915-104429937 GAGTCCAAACATCAGCAGGCAGG - Intronic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1039432126 8:37533161-37533183 CAGGGCTAAAATCAGGGGGTGGG + Intergenic
1041296858 8:56365712-56365734 AAGTCCATACATCAGTAGGTAGG + Intergenic
1041455126 8:58050829-58050851 CAGGGCATACACCAGGGGGTGGG + Intronic
1041616336 8:59911401-59911423 CAGTGAAACCATCAGGTGCTGGG - Intergenic
1042788569 8:72577805-72577827 CTGTGCAAATATCCTGAGGTTGG - Intronic
1044543944 8:93438124-93438146 CTGTGGAACAATCAGGAGGTTGG - Intergenic
1044942028 8:97353201-97353223 GGGAGCAAACATCAGGAGATGGG + Intergenic
1045512437 8:102822738-102822760 CAGTCCAAACCCCTGGAGGTGGG + Intergenic
1045820092 8:106326696-106326718 CAGTGCAAGGACCATGAGGTGGG + Intronic
1046562469 8:115855329-115855351 AAGTGCAAAGATCTTGAGGTAGG - Intergenic
1050223200 9:3420169-3420191 CAGTGCAAAAATCTGGAAGAAGG - Intronic
1050555966 9:6789941-6789963 CAATGCACACATGAGGAAGTAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1054865485 9:69996111-69996133 CAGTGGAAACATAATAAGGTAGG + Intergenic
1056131554 9:83592134-83592156 TTGTGCAAACATCAGGTCGTGGG + Intergenic
1056678468 9:88696755-88696777 CATCGCAAACTTCAGGAGATGGG + Intergenic
1057467138 9:95324416-95324438 AAGTCCATACATCAGTAGGTAGG + Intergenic
1057968840 9:99533343-99533365 CATTGAAAACTTCAGGAGCTGGG - Intergenic
1058337408 9:103848373-103848395 AAGTGTGAACACCAGGAGGTGGG - Intergenic
1060946171 9:127570247-127570269 CTGTGCACACCACAGGAGGTAGG + Intronic
1062567245 9:137168709-137168731 CACTGCATACACCGGGAGGTGGG - Exonic
1185735371 X:2491814-2491836 CTGTGCAAACATCAGGCAGTCGG + Intronic
1188725163 X:33573937-33573959 CAGTGCACACATGTGGTGGTGGG + Intergenic
1188803237 X:34557310-34557332 CAGTGTAAAAATCAGCAGGCAGG + Intergenic
1189600187 X:42615755-42615777 GAGTGCAAACATGGGCAGGTGGG - Intergenic
1192765940 X:74139717-74139739 CAGTCCAATCATGATGAGGTGGG + Intergenic
1195001398 X:100646623-100646645 TAGTACAAACATGAGAAGGTTGG + Intronic
1195671078 X:107470667-107470689 GGGTGTGAACATCAGGAGGTGGG + Intergenic
1199903695 X:152203597-152203619 CTGTGCTAAAATCAGGATGTAGG + Intronic
1200768926 Y:7105786-7105808 CACTGCTAACATGAGGAGGTGGG + Intergenic
1200838072 Y:7752475-7752497 AAGTGTGAACACCAGGAGGTAGG - Intergenic
1202051425 Y:20784723-20784745 CAGTGCAAACATTAGCATGGTGG + Intergenic