ID: 1099196675

View in Genome Browser
Species Human (GRCh38)
Location 12:79625181-79625203
Sequence CTAGTTTTCCATTTCTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099196672_1099196675 19 Left 1099196672 12:79625139-79625161 CCTATGGTTAAGAGTCATTTGCA 0: 1
1: 0
2: 2
3: 21
4: 114
Right 1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG 0: 1
1: 0
2: 1
3: 36
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099196675 Original CRISPR CTAGTTTTCCATTTCTCTAT AGG Intronic
900758472 1:4454370-4454392 CTAGCCTTCCACTCCTCTATGGG - Intergenic
901918289 1:12517035-12517057 CAAGTTTTCCATTTCTTCATAGG + Intergenic
905266366 1:36756724-36756746 CTGCTTTTCCATTTCTCTAAGGG - Intergenic
905491996 1:38351724-38351746 CTAATTCTTCATTTCTTTATGGG + Intergenic
906531872 1:46528349-46528371 ACAGTTTTCTATTTCTCTGTGGG - Intergenic
906925831 1:50115393-50115415 CTAGTTTTGCATTTTACTTTTGG - Intronic
907062820 1:51448491-51448513 CTCTTTTTCCATTTTTCTATTGG - Intronic
908051647 1:60239323-60239345 CTATTTTTCCATTTCGAAATGGG - Intergenic
908647883 1:66299143-66299165 GTAGTTTTCTATTGCACTATGGG - Intronic
908668596 1:66520521-66520543 CTGCTTTTCCTTTCCTCTATGGG - Intergenic
908860379 1:68479635-68479657 CTAGTTTTTTATTTCTTCATAGG - Intronic
910021833 1:82600388-82600410 CTTGTAATACATTTCTCTATAGG + Intergenic
910060339 1:83084171-83084193 TCAGTTTTCCATTTCTATTTTGG - Intergenic
910476082 1:87608959-87608981 ATAATTTTCCATCCCTCTATAGG - Intergenic
911554179 1:99323018-99323040 CTACTTTTTCATTTCTTTTTTGG - Intergenic
912189870 1:107325241-107325263 CTAGTTTTTCAGTTCGTTATAGG - Intronic
912364809 1:109124628-109124650 CTATTTCTCCATTTATCTTTTGG + Intronic
912588106 1:110785437-110785459 CTAGTTCTCAATCTCTCTTTAGG - Intergenic
915329571 1:155101999-155102021 CTCTTTGGCCATTTCTCTATTGG - Intergenic
918437510 1:184531600-184531622 TTAGTTTTCCATTTTTCTTTTGG + Intronic
918545229 1:185674925-185674947 CTGTTTTTCAATTTCTCTACAGG - Intergenic
919147003 1:193648529-193648551 CTAGACTTCCATTACTATATTGG + Intergenic
921243259 1:213208999-213209021 CTAGTCCTTCCTTTCTCTATTGG + Intronic
921408828 1:214812681-214812703 CTCGTTTTCCATTCTTCTTTGGG - Intergenic
921452755 1:215328439-215328461 CTAGTTTTCTCTTTCCCTGTTGG - Intergenic
923596423 1:235363721-235363743 CTTTTTGTCCATTTTTCTATTGG + Intergenic
1064072329 10:12241430-12241452 CTTGTTCTCCATTTCAATATTGG + Intronic
1064739482 10:18417765-18417787 TTATTTTTCCATTTCTCTACAGG - Intronic
1067274152 10:44819586-44819608 CCATTCTCCCATTTCTCTATGGG - Intergenic
1067366828 10:45639214-45639236 ATATTTTTCCATTTTTCTATTGG - Intronic
1067412325 10:46076063-46076085 CTTGTTCTCCAGTTCTCTAAGGG + Intergenic
1067800143 10:49353158-49353180 CTTGGTTCCCATTTCTCTGTGGG - Intergenic
1067902811 10:50259701-50259723 CTGGTTCTCCATTCCTTTATGGG + Intergenic
1071062170 10:81584834-81584856 CTGCTTTGCCATTTCTTTATTGG + Intergenic
1071979566 10:90989842-90989864 TTACTTATCCATTTCCCTATTGG + Intergenic
1072619409 10:97069624-97069646 CTCATTTTCCATTTCTGTCTGGG - Intronic
1073503267 10:103962280-103962302 ATACTTTTCCATTTGTATATTGG - Intergenic
1077733098 11:4756527-4756549 CTTAATTTCCATTTCTTTATAGG - Intronic
1078047775 11:7932843-7932865 CTAGTTTTTCTTTTCTATTTTGG - Intergenic
1079636588 11:22749707-22749729 CTATGTTTCCATTTCTCAAGAGG - Intronic
1080636533 11:34129027-34129049 TTATTTTTCCATTTATCTGTTGG + Intronic
1080788335 11:35496594-35496616 CTTGTTTTCCATTTTTCCCTTGG - Intronic
1081338618 11:41900060-41900082 TTAGTGTACCATTTTTCTATAGG - Intergenic
1081408092 11:42721524-42721546 CAATTTTTCCCTTTCTCTTTAGG + Intergenic
1082968289 11:58991265-58991287 CTTGTTTTCCATTTCATTATAGG + Intronic
1085021143 11:73209196-73209218 CTAGTTTGTCATTTGTCTTTAGG - Intergenic
1085141053 11:74142088-74142110 TAATTTTTCCATTTCTCTATCGG + Intronic
1086266379 11:85003687-85003709 CTAATTATCCATCTATCTATAGG - Intronic
1086805546 11:91237162-91237184 CTAGTTTTCAATTGCTGTGTAGG + Intergenic
1086859786 11:91911834-91911856 CTGGTTTTCCATTCTTATATAGG + Intergenic
1087485640 11:98756876-98756898 CTATTTTTTCTTGTCTCTATTGG + Intergenic
1087551534 11:99656690-99656712 CCAGTCTTCCATGTCTCTAGTGG - Intronic
1087635648 11:100698303-100698325 CTAATTTTCTTTTTTTCTATAGG - Intronic
1087995510 11:104802626-104802648 CTTGATTTGCATTTCTCTAATGG - Intergenic
1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG + Intronic
1088177024 11:107065226-107065248 CAAGGTTTCCATTTATCTTTTGG + Intergenic
1088209020 11:107432211-107432233 ATTGTTTTCCATTTTTCTTTTGG - Intronic
1088708848 11:112487994-112488016 CTGATTTTCCATCTCTCAATAGG + Intergenic
1088778145 11:113106848-113106870 CCATTTTTACATTTCTCTCTGGG - Intronic
1088888422 11:114025864-114025886 CTCCTTTTCCATCTCTCTCTTGG + Intergenic
1090527201 11:127549597-127549619 CTAGTTTTCCACATTTTTATTGG - Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1091467135 12:694556-694578 TTAGTTTTCCATTTCTTAACTGG + Intergenic
1092518037 12:9236528-9236550 CTTCTTGTCCTTTTCTCTATAGG - Intergenic
1092694598 12:11156282-11156304 CTACTTTTCAAATTTTCTATTGG + Intronic
1092710780 12:11335135-11335157 TTTGATTTCCATTTCTCTAATGG + Intergenic
1095353508 12:41243716-41243738 GTACTTTTTCATTTCTCTATGGG + Intronic
1095607173 12:44083055-44083077 TTATTTATCCATTTTTCTATCGG + Intronic
1096928896 12:55182282-55182304 TTTGATTTCCATTTCTCTAATGG - Intergenic
1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG + Intronic
1097925164 12:65119229-65119251 CGAGGTTTCCATTGCTCTATAGG - Intronic
1098306839 12:69110742-69110764 CTAGTTTTGCTTTACTCTATAGG - Intergenic
1098324206 12:69284194-69284216 CGAGTTGACCATTTTTCTATTGG - Intergenic
1098808125 12:75047906-75047928 TTGGTTTGCCATTTGTCTATGGG - Intronic
1098985798 12:77010606-77010628 CTTTTCTTGCATTTCTCTATTGG + Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099998446 12:89805751-89805773 CCAGTTTTCCATTTGTCTCAGGG + Intergenic
1100006631 12:89902431-89902453 CTAGATTTCCATTTCACTGGTGG + Intergenic
1100039546 12:90298137-90298159 CTAGTTTGCCCTTTCACTAAGGG + Intergenic
1101684787 12:107008267-107008289 CTAGATTTTCATTTTTCTTTTGG - Intronic
1101780812 12:107833569-107833591 ATTATTTTCCATTTGTCTATTGG + Intergenic
1102835668 12:116056827-116056849 CTAGTAATTCATTTCTCTCTAGG - Intronic
1102968400 12:117146939-117146961 CTTATTTTCTATTTCTCTAGTGG - Intronic
1104090887 12:125516838-125516860 CAAATTTTCAATTTCTCTTTGGG - Intronic
1104264224 12:127216053-127216075 CTAGTGTTCTATTCCACTATAGG - Intergenic
1104282509 12:127390870-127390892 CAAATTTTCAATTTCTCTTTGGG + Intergenic
1104489059 12:129178505-129178527 TTTGATTTCCATTTCTCTAATGG + Intronic
1104659866 12:130603428-130603450 TTCCTTATCCATTTCTCTATTGG - Intronic
1105710019 13:22998588-22998610 CTAGTTTTCCATCTTTCTGCAGG + Intergenic
1107295205 13:38900486-38900508 CTAGTTTTCCATTTTGCAAATGG - Intergenic
1107750509 13:43560656-43560678 CTAATTTTTCATTTGTCTATTGG + Intronic
1108963624 13:56268825-56268847 CAAGTTTTCCATTTTCTTATTGG + Intergenic
1109006032 13:56877969-56877991 CTTAGTTTGCATTTCTCTATTGG + Intergenic
1109240777 13:59884514-59884536 CTAATTCTTCAGTTCTCTATGGG + Intronic
1109472626 13:62829884-62829906 CTAGTTTTATTTTACTCTATAGG - Intergenic
1109551851 13:63914432-63914454 CTATTTTTCCACTTAACTATTGG + Intergenic
1110156517 13:72323240-72323262 CTTGATTTGCATTTCTCTAATGG - Intergenic
1110339958 13:74378158-74378180 CTAGGTTTTAATTTGTCTATTGG - Intergenic
1110384079 13:74888334-74888356 TTACTCTTCCATTTCTCCATAGG - Intergenic
1112342969 13:98567577-98567599 TTATTTTTCCATCTCTCTACTGG - Intronic
1113706673 13:112439088-112439110 CTAGTTTTCCTTGTTCCTATGGG + Intergenic
1114413432 14:22521477-22521499 CTAGTTTTCTACTTCACTTTTGG - Intergenic
1114435571 14:22704436-22704458 CAAGTTTTCTATTTCTCCTTAGG - Intergenic
1114930049 14:27455125-27455147 TTTGTTTTCCATTTCTCCATGGG + Intergenic
1114996957 14:28365583-28365605 CTATTTTTCCAGTACTCTCTAGG + Intergenic
1115809735 14:37093447-37093469 CTAGTCTTTTCTTTCTCTATGGG + Intronic
1115966890 14:38900213-38900235 CTATTTTTTAAATTCTCTATTGG + Intergenic
1116278800 14:42874093-42874115 CTATTTTTCCATCTCATTATTGG + Intergenic
1116468649 14:45262113-45262135 CTAGTTTTCTATATCACTGTAGG - Intergenic
1116485107 14:45438516-45438538 CTTGATTTCAATTTCTTTATTGG - Intergenic
1116544009 14:46140050-46140072 CAAATTTTACATTTTTCTATAGG + Intergenic
1117278068 14:54209438-54209460 CTACTTTTCCTTCTCACTATAGG - Intergenic
1118108373 14:62687642-62687664 CTTAATTTGCATTTCTCTATTGG - Intergenic
1120224769 14:81778267-81778289 CTAAATTACTATTTCTCTATTGG + Intergenic
1120607391 14:86595987-86596009 CTAGTTTTTTATTTTTCTGTTGG - Intergenic
1121017729 14:90558549-90558571 CTATTTTTCCATTTTTAAATAGG + Intronic
1121909117 14:97773033-97773055 TTAGTTTTCCATAGCTGTATAGG - Intergenic
1121967238 14:98321616-98321638 AAAGTTTTCCTCTTCTCTATGGG - Intergenic
1125240653 15:37571105-37571127 CTATGTTTGCATTTCTCTAATGG - Intergenic
1125837199 15:42763042-42763064 CTAGTGTTCCATAGCACTATAGG + Intronic
1126308266 15:47286167-47286189 TTAGGTTCCCATTTCTCTGTAGG - Intronic
1126975052 15:54168002-54168024 ATAGTTCTCCCTTTCTCCATAGG - Intronic
1127930148 15:63590381-63590403 CTAGTTTTCCATGTTTCCGTAGG + Intronic
1128461755 15:67874141-67874163 CCTGTTTTCCATTTCTTGATTGG + Intergenic
1130404875 15:83589818-83589840 CTATTATACCATTTCCCTATTGG + Intronic
1130739255 15:86580774-86580796 CTAGTGTTCCATAGCACTATAGG - Intronic
1130882374 15:88066425-88066447 CTGTGTGTCCATTTCTCTATGGG - Intronic
1133491029 16:6268239-6268261 CTAGATTTACATCTCTTTATGGG + Intronic
1139210188 16:65069627-65069649 CTATTTTTCCGTTTCTATTTTGG - Intronic
1140074795 16:71688586-71688608 CTAGTATTAAATTTCTCTGTGGG + Intronic
1140334353 16:74090576-74090598 CTAGTTTTGTATTTTTCTTTGGG + Intergenic
1140423204 16:74838176-74838198 CTATTTCTTCATATCTCTATAGG - Intergenic
1141229374 16:82150470-82150492 TTAGTTTTCCTTTTCTTTTTTGG - Intronic
1142651248 17:1353815-1353837 CTGGTTTCCCATTTCCCTCTGGG - Intronic
1143602113 17:7954001-7954023 TTAGTTTTCAATTCCTCTAAGGG - Intergenic
1143916665 17:10298821-10298843 CTAGTTTCACATCTCTCTCTCGG - Intronic
1144301312 17:13924824-13924846 CCAGTTTTCCATTTCATTGTTGG - Intergenic
1144385833 17:14748365-14748387 TAATTTTTCCATTTCTCTGTAGG - Intergenic
1144560172 17:16314888-16314910 CCATTTTTCCAGTTCTCCATGGG - Intronic
1146247408 17:31301079-31301101 CCAGTTTGCCATTTGTCTTTTGG + Intronic
1148340766 17:46872260-46872282 CTATTTTCCTATTTCCCTATTGG - Intronic
1149983230 17:61328229-61328251 CTAGTTTTTTCTTTCTCTATAGG - Intronic
1150487917 17:65556742-65556764 CTGGATTTCCCTTTCTCTGTAGG - Intronic
1150593413 17:66582714-66582736 GTAGTTTTCCATTCCCCTAGTGG + Intronic
1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG + Intergenic
1155027279 18:21953004-21953026 CTATTTTTCCATTTATTTAAAGG + Intergenic
1155283693 18:24267246-24267268 TTAGTTTTCTATTTCTTTTTGGG - Intronic
1155646393 18:28083340-28083362 CTAGCTATCCATGTTTCTATTGG - Intronic
1155814352 18:30286559-30286581 TTTGTTTTGCATTTCTCTAATGG - Intergenic
1156922503 18:42539947-42539969 CTTTTTGTCCATTTCTCCATTGG - Intergenic
1158027470 18:52917816-52917838 CTAGTTTAGCATTTCCCTATTGG - Intronic
1158090300 18:53703393-53703415 GTATTTTTCCATTTTTCAATTGG + Intergenic
1158149727 18:54354851-54354873 CTGTTTTTCCATTTCTCTCAAGG + Intronic
1158427838 18:57354215-57354237 CTAGTTTTCTTTTTTTCTCTCGG + Intronic
1159555947 18:69944928-69944950 TTAGTTTTCCCTTTCTCTTTAGG - Intronic
1159788809 18:72750605-72750627 CTGGTTTTCCTCTTCTCTATAGG + Exonic
1159970895 18:74650878-74650900 CTACATTTCCATTTCTGTAGTGG + Intronic
1164194793 19:22946753-22946775 CTTCTTTTCCACTTCTCTGTAGG - Intergenic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1165026111 19:32963052-32963074 CTTATTTTGCATTTCTCTAATGG - Intronic
1165592878 19:36986246-36986268 CTGGTTTTCCCTTACTCTAAGGG + Intronic
1167848196 19:52181743-52181765 CTAGATTTCCATTTTTTTAAAGG + Intergenic
1168653480 19:58109536-58109558 CAAGTTTTCCATTTCCCAGTTGG - Intronic
925757719 2:7149632-7149654 CAAGCTTTCCATTACTGTATGGG + Intergenic
926085426 2:10016817-10016839 CTAGTTTTCTAGTTGTTTATGGG - Intergenic
927301568 2:21521718-21521740 CTTGATTTGCATTTCTCTAATGG + Intergenic
927367176 2:22311084-22311106 CTAGTGTTCTATAGCTCTATAGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928315749 2:30244034-30244056 CTAGTTTTCCATTTATGTAGTGG + Intronic
929726326 2:44431826-44431848 CTAGTTCCCCATTTCCCAATGGG - Intronic
929863716 2:45700287-45700309 TTAGTTTTCCATTTCTTTGGGGG - Intronic
930215211 2:48689489-48689511 CTTGGTTTCTATTTCTCTGTTGG - Intronic
930239336 2:48919926-48919948 GCAGTTTTCCTTTTCTCCATGGG + Intergenic
930241970 2:48945174-48945196 CCAGTTTTCCATTTCTCTCCAGG - Intergenic
930389218 2:50739059-50739081 CTAGTTTTATATTTCTTTGTAGG - Intronic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
932333054 2:70910658-70910680 ATATTTAGCCATTTCTCTATCGG + Intronic
933124562 2:78588070-78588092 CTATTTTCCCATTTCTCTCTGGG - Intergenic
933211187 2:79571190-79571212 CCTGTTTTCCATTTCTCATTTGG + Intronic
934160390 2:89243988-89244010 GTACTTTTCCAGTTTTCTATGGG + Intergenic
934206885 2:89938450-89938472 GTACTTTTCCAGTTTTCTATGGG - Intergenic
934745798 2:96758877-96758899 TTATTTTTCCTTTTCTTTATTGG + Intergenic
934874066 2:97897906-97897928 CTAATTTTCTAATTCTCTCTTGG + Intronic
934998052 2:98984699-98984721 GTCCTTTTCAATTTCTCTATGGG - Intergenic
935928775 2:108100203-108100225 GCAGTTTTCCATATCTGTATGGG - Intergenic
937171192 2:119871045-119871067 CTATCTTCCCATTTTTCTATTGG - Intronic
938673998 2:133612335-133612357 CAAGTTTTTCTTTTCTCTTTGGG - Intergenic
939359720 2:141154482-141154504 CAAATTTTTCATCTCTCTATGGG + Intronic
940218969 2:151331359-151331381 TTAATTTTGCATTTCTCTAATGG + Intergenic
940935483 2:159489592-159489614 CTAGATTTCAATTTCTTTTTCGG - Intronic
941224271 2:162826852-162826874 TGTGTTTTCCTTTTCTCTATTGG - Intronic
941336606 2:164252919-164252941 CTGGTTTTCCTTTTCTGCATTGG - Intergenic
941379133 2:164769929-164769951 CTTGTTCTCCCTTTCTCTTTAGG + Intronic
942367654 2:175244685-175244707 CTATTTCTCCATTTTTGTATGGG - Intergenic
942370221 2:175276021-175276043 CAAGTTTTCCAAGTCTCTTTAGG + Intergenic
943388291 2:187229403-187229425 TCAGATTTCCATTTCTCTCTTGG + Intergenic
943823385 2:192356712-192356734 GTAATATTCCATTTTTCTATGGG - Intergenic
944728188 2:202493208-202493230 CTAGGTTTCCATTTTTCTAGTGG + Intronic
945225125 2:207525996-207526018 CTACTTTGACATTTCTCTCTTGG - Intergenic
945289121 2:208110438-208110460 CTAAGTTTCCATTTTTCTAAAGG - Intergenic
945378495 2:209109777-209109799 CTAGTTTTTCATATCACAATAGG + Intergenic
945646655 2:212504486-212504508 TTTTTTTTCTATTTCTCTATAGG - Intronic
946579032 2:221106630-221106652 ATACTTTTCCAGTTCCCTATTGG + Intergenic
946807414 2:223485114-223485136 CTTGTTTTCTCTTTCTCTATAGG + Intergenic
947258831 2:228198015-228198037 CTAATTTTCTATTTTTCTAAAGG - Intergenic
947354599 2:229279191-229279213 TTTGATTTCCATTTCTCTAATGG - Intergenic
947685072 2:232076590-232076612 CTTTTCTTCCATTTTTCTATTGG + Intronic
948507473 2:238439118-238439140 CTAGTTTTCCTTTGCTTAATTGG + Intronic
1168734482 20:118638-118660 CTACTTTTCCAATGCTCCATTGG + Intergenic
1169514891 20:6304907-6304929 CTTGGTTTCCATATCTCTCTTGG + Intergenic
1170514120 20:17110243-17110265 TTTGATTTCCATTTCTCTAATGG + Intergenic
1171723631 20:28593783-28593805 CTAATTTTCTTTTTCTCCATTGG - Intergenic
1171946875 20:31386734-31386756 CTAGTGTTCCATAGCTCTGTAGG + Intronic
1172024712 20:31940341-31940363 CTCTTTATCCATTTTTCTATGGG + Intronic
1173441538 20:43081313-43081335 CAAGTTTTCCATTTATCAATTGG + Intronic
1176699806 21:10031964-10031986 TTACTTAGCCATTTCTCTATTGG - Intergenic
1176902793 21:14463607-14463629 ATATTTTTCTATTTCTGTATAGG + Intergenic
1176953542 21:15073530-15073552 CTATGTTTCCTTTTCTCTGTAGG + Intergenic
1177436352 21:21058358-21058380 CTAGTTTCACATTTATCTGTTGG + Intronic
1177693458 21:24540512-24540534 CTAGTTTTCCATTTTGTAATGGG - Intergenic
1177804445 21:25860269-25860291 CTTGTTCTCCATTTCTCAGTGGG - Intergenic
1178092851 21:29182890-29182912 CTCGTTTCCCATTTCTAGATAGG - Intergenic
1178382243 21:32120504-32120526 CTGGATTTCCATTTGTCTCTGGG + Intergenic
1178597202 21:33964681-33964703 CTATTTTTCCATCTCTATACTGG - Intergenic
1180018931 21:45107534-45107556 CTAGATTTCCATCTATATATGGG - Intronic
1181337367 22:22148149-22148171 CTATTTTTGCTTTTCTCTGTTGG - Intergenic
1181894537 22:26095434-26095456 CTATTTTTCCATTTCTAAAATGG - Intergenic
1182173861 22:28262782-28262804 CTAGTTCTCCATTTCTACTTGGG - Intronic
949103406 3:174121-174143 CTTGGTTTCATTTTCTCTATTGG - Intergenic
949333989 3:2953462-2953484 CTTCTTCTCCATTTGTCTATTGG + Intronic
949916645 3:8969612-8969634 CTAGTTTTCAACTTCTTTACTGG - Intergenic
950371121 3:12531548-12531570 GTGGTTTTTCATTTCTCAATAGG + Exonic
952814391 3:37434616-37434638 ATAGTTTTCAATTTCCCTTTAGG + Intronic
953543071 3:43839832-43839854 CTATTTTTCCTTTTCTCTGTGGG + Intergenic
953604207 3:44399331-44399353 CTATTTTTCAATTTTTCCATGGG - Intronic
954095576 3:48324827-48324849 CTAGTCTTCTATTTCCTTATTGG + Intronic
954592577 3:51795968-51795990 CTATTTTTTCATTGCTTTATGGG + Intergenic
954995547 3:54878127-54878149 CTAGTGTTGCAGTTTTCTATCGG + Intronic
955257694 3:57350806-57350828 TCACTTGTCCATTTCTCTATTGG - Intronic
955555239 3:60129948-60129970 AGAGTTTTACATTTCTCTTTAGG + Intronic
956575956 3:70753059-70753081 CTAGTTTTCCATTTGCTTACTGG + Intergenic
956654530 3:71536149-71536171 CCAGTTTTCAATTTCACCATGGG + Intronic
957993483 3:87657069-87657091 ATAGTTTGTCATTTCTCTTTAGG - Intergenic
959561091 3:107782349-107782371 CTAGGCTACCATTTCTGTATTGG - Intronic
959655409 3:108798840-108798862 CTAGTTTCACATTTTTCTTTTGG + Intergenic
959955298 3:112230782-112230804 CTAGTTTTCATTTTCTCTCCAGG - Intronic
960167727 3:114422767-114422789 CAATTTTTCCATTTCTCATTTGG + Intronic
960272446 3:115689730-115689752 CTACTCTCCCTTTTCTCTATAGG - Intronic
961161352 3:124729355-124729377 CTAGTGTTCCATTGCACTGTAGG - Intergenic
961229302 3:125287867-125287889 TTCTTTTTCCATATCTCTATCGG - Intronic
962276239 3:134016449-134016471 CTTGTTTTGCATTTCCCTAATGG - Intronic
962628098 3:137247583-137247605 CTAGTTTTCTATTGCACAATAGG - Intergenic
962934906 3:140071387-140071409 CTTGTTTTTCATGTCTCTGTTGG - Intronic
963405894 3:144863840-144863862 CTAGATTTCCATTTCCATTTGGG + Intergenic
963699600 3:148607912-148607934 CTTGTTTTTCATTTTTCCATAGG + Intergenic
963946196 3:151148084-151148106 TTTGATTTGCATTTCTCTATCGG + Intronic
963975275 3:151473336-151473358 ATAGTTTTCCATTCCTCCCTTGG - Intergenic
965889206 3:173489809-173489831 TTTGTTTTCCATTTCTCTGATGG + Intronic
966585810 3:181622993-181623015 CTAAGTTTCCATGTCTCTCTAGG - Intergenic
966693448 3:182764328-182764350 ATAGTGATTCATTTCTCTATTGG - Intergenic
966759111 3:183400520-183400542 CTCGCTCTCCATTTCTCTCTAGG + Intronic
968971076 4:3794479-3794501 CAAGTCTTCTATTTCTTTATTGG - Intergenic
969952987 4:10858236-10858258 CTTGTTTTCTATTTCTTTTTGGG + Intergenic
971257325 4:25026960-25026982 CAAGTTTTACATCTCTCCATTGG - Intronic
972146108 4:36027740-36027762 CTAATTATCCATTTATCTTTGGG - Intronic
973267838 4:48229254-48229276 GTAGGTTTCCATTTCTCTTGTGG - Intronic
974570799 4:63646170-63646192 TTATTTTTCCACTTCTGTATTGG + Intergenic
974813186 4:66972291-66972313 TTAGTTTCACATTTCTCCATGGG - Intergenic
976144683 4:82031053-82031075 TTAGTTTTCCATCTCTAAATAGG + Intronic
976322837 4:83734900-83734922 ATAGTTTTCCCTTTATCTTTGGG + Intergenic
976380987 4:84398448-84398470 CCAGTATTCCATTCCTCTTTTGG - Intergenic
976447322 4:85146119-85146141 ATAGTTTTGCATTTGACTATTGG - Intergenic
976933713 4:90602395-90602417 TTATATTTGCATTTCTCTATAGG + Intronic
977413443 4:96697911-96697933 AGAGTTTTCCATTTCCCAATGGG - Intergenic
977564555 4:98568084-98568106 CAAGTGTTCATTTTCTCTATTGG - Intronic
978003621 4:103589181-103589203 TTAATTTTCCATTACTCTAGTGG + Exonic
978097271 4:104793286-104793308 CTGGTTTTCCATTTCCTTAAAGG - Intergenic
978647552 4:110955606-110955628 CTAGCTTTGAATTTCTTTATTGG - Intergenic
979482522 4:121236370-121236392 CTAGTTTTACTTTTGTCTTTTGG + Intergenic
979912813 4:126391209-126391231 CTGTTTTTCCATTTTTCTTTTGG + Intergenic
980262586 4:130471497-130471519 TAAGTATTCCATTTCTATATCGG - Intergenic
980886404 4:138767236-138767258 CTTGTTTTCCTCTTTTCTATTGG + Intergenic
981601734 4:146496706-146496728 ATAGTTTTCCCTGTCTCTTTGGG + Intronic
982133424 4:152250119-152250141 CTAGTTTCCCATTTTTCACTTGG - Intergenic
982493277 4:156056953-156056975 TTAGTTTTCCAATTCTTTTTGGG + Intergenic
983009960 4:162535886-162535908 TTAGTTTTCCATTGCTCTGTGGG + Intergenic
983185864 4:164699848-164699870 TTACTTTTCCATTTCTCCTTAGG - Intergenic
984116239 4:175684232-175684254 CTAGTTTGCCATTTGTCTTTTGG + Intronic
984159437 4:176233481-176233503 GTCTTTTTTCATTTCTCTATTGG + Intronic
984361895 4:178744571-178744593 CTAGTTTTCCATTTTGGTGTTGG - Intergenic
986614625 5:9603764-9603786 CAAATGTACCATTTCTCTATAGG + Intergenic
987003395 5:13684464-13684486 TTAGTTTTCCAAGGCTCTATTGG - Intergenic
988165339 5:27581941-27581963 TTAGTTTTCCATTTTTATTTGGG + Intergenic
989301298 5:39896971-39896993 CTAGTTTTCCTTTTCTCACAAGG + Intergenic
989747715 5:44850248-44850270 TTAGCTTTCCATTTTTATATAGG + Intergenic
990384696 5:55249030-55249052 CTAGTTTGCCATTTTTAAATAGG + Intergenic
990392343 5:55337578-55337600 CCACTTTTTCATTTCTCTTTTGG + Intronic
991920145 5:71648411-71648433 CTATTTTTCCATTTCAATAGAGG - Intronic
991988592 5:72315646-72315668 TTTGTTTTGCATTTCTCTAATGG - Intronic
993130556 5:83892964-83892986 CTAGTTTCACATTTCCCTGTGGG + Intergenic
995397865 5:111707261-111707283 TTTGCTTTCCATTTCTTTATAGG + Intronic
995462972 5:112421484-112421506 TTTCTTTTCCATTTCTTTATCGG + Intergenic
996444920 5:123536482-123536504 CTAGTTTTCCATACCACTGTAGG + Intronic
996518200 5:124396943-124396965 CTAGTTTTCTCTTTCTCCCTTGG + Intergenic
996808295 5:127483037-127483059 CTAGTGTTCCATAGCACTATAGG - Intergenic
997342977 5:133160375-133160397 CAAGTTTTCTATTGCTCCATTGG + Intergenic
999006144 5:147981657-147981679 CTATTTATCCATTTATTTATCGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999952948 5:156669766-156669788 CATGATTTCCATTTCTCTGTAGG + Intronic
1000525001 5:162346717-162346739 TTTGATTTGCATTTCTCTATTGG + Intergenic
1002144597 5:177169278-177169300 GTCGTTTACCATTTCTCAATCGG - Intronic
1003782890 6:9449135-9449157 TTTGATTTGCATTTCTCTATTGG - Intergenic
1003843207 6:10144373-10144395 ATACTTTGCCATTTTTCTATTGG - Intronic
1004616168 6:17291734-17291756 TTTGTTTTCCATTTCTCAACAGG + Exonic
1005384189 6:25269633-25269655 CTGTTTTTCCTTTTCTTTATGGG + Intergenic
1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG + Intergenic
1005993875 6:30920276-30920298 CTAGTTTCTTATTTCTCTAGAGG + Intronic
1007160959 6:39791821-39791843 CAACTTTTCCATTTCTTTTTTGG - Intergenic
1007333452 6:41133253-41133275 ATTGTTTTCCATTTTTTTATAGG + Intergenic
1009826891 6:68878572-68878594 CAGATTATCCATTTCTCTATAGG - Intronic
1009964120 6:70559685-70559707 CTAATTTTCCTTTTTTCTGTTGG + Intronic
1009964895 6:70567337-70567359 CTTCTTTTCCATTTTTCTCTGGG - Intronic
1010046046 6:71445221-71445243 CTAGATCTCTATTTCTCAATAGG - Intergenic
1011553044 6:88547474-88547496 CTAGTTTTCCATTCCCCTTGGGG + Intergenic
1011773651 6:90703672-90703694 CAAGGTTTCCAATTCTATATTGG + Intergenic
1012396845 6:98808106-98808128 TTAGTTTTGCATTTCTAAATTGG - Intergenic
1012807259 6:103909807-103909829 CTAGTTTGGTATTTCTCTAATGG + Intergenic
1013933684 6:115567953-115567975 TTTGATTTCCATTTCTCTAATGG - Intergenic
1015011297 6:128351909-128351931 TCAGTTTTACATTTTTCTATTGG + Intronic
1015166108 6:130201898-130201920 TTACTTCTCCATTTCTCTTTTGG + Intronic
1015637695 6:135294550-135294572 TTATTTTTCTATTTCTCTTTTGG - Intronic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1016653917 6:146495942-146495964 CTCATTTTCCATTTTTCTATAGG - Intergenic
1017070636 6:150573041-150573063 CTTGACTTCCATTTGTCTATTGG + Intergenic
1017382809 6:153849758-153849780 TTAGTTATCCATTCATCTATTGG - Intergenic
1017585889 6:155922245-155922267 ATATTTTTCAATTTCCCTATGGG + Intergenic
1018118029 6:160607050-160607072 CTAGTTCTCCGTATCTCTCTCGG + Intronic
1018718032 6:166550185-166550207 CCAGTTTTCTATTTCTGTATAGG - Intronic
1020455816 7:8372862-8372884 TTATTTTTCTTTTTCTCTATTGG + Intergenic
1021298078 7:18934326-18934348 GTACTTTTCCATTCCTGTATTGG - Intronic
1021724397 7:23535206-23535228 CCTATTTTCCATTTTTCTATTGG + Intergenic
1021785378 7:24146391-24146413 CTGGATTTCCATTTCTGTAGTGG + Intergenic
1024478144 7:49835629-49835651 GTAATTTTCCATTTCTTCATAGG - Intronic
1024810620 7:53207319-53207341 TCAGTTGTCCTTTTCTCTATTGG - Intergenic
1026115388 7:67491484-67491506 CTAGTTTTAGATTACTCCATTGG - Intergenic
1027345970 7:77260002-77260024 TTTCTTTTCCATTTCTCTGTAGG - Exonic
1028495736 7:91457931-91457953 TTGGTTTTCCATTTGTCTCTTGG - Intergenic
1029869137 7:103670305-103670327 CTAGTTTTCCTTTTCCTTTTAGG + Intronic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1031894339 7:127331010-127331032 ATAGTTTTCCATTTTTAGATGGG - Intergenic
1032579916 7:133094759-133094781 TTCTTTGTCCATTTCTCTATTGG + Intergenic
1032648314 7:133850534-133850556 CTAATATTCCATTTCTCTTTGGG + Intronic
1033983785 7:147198046-147198068 CAAGTTTTTCATTTGTCTTTAGG - Intronic
1034679884 7:152920534-152920556 CTGGTTTTCCATCTTTCTATTGG - Intergenic
1035596311 8:860866-860888 CTACTTTACCATTTCTTCATAGG - Intergenic
1035987566 8:4451482-4451504 CTTGTTTAATATTTCTCTATGGG - Intronic
1037246844 8:16845067-16845089 CTAGCTTTCCTTTTATCGATAGG - Intergenic
1038989522 8:32852589-32852611 TTAGGTTTCCATCTCTTTATTGG + Intergenic
1039309592 8:36301988-36302010 CTATTTATCCATCTATCTATTGG + Intergenic
1042481296 8:69306653-69306675 CTTGATTTGCATTTCTATATAGG - Intergenic
1043451281 8:80369778-80369800 TTAGTATTTCATTTCTCTATTGG - Intergenic
1044057045 8:87584392-87584414 CTAGTTTTCCTTTACTGTCTAGG + Intronic
1048452356 8:134544608-134544630 CTATTTTTTCATTTTTCTGTTGG - Intronic
1050753952 9:8976938-8976960 CTACTTCTCCATTTGTCTGTTGG + Intronic
1050919017 9:11175558-11175580 CATGTTTTCCATCTGTCTATTGG - Intergenic
1051878683 9:21817729-21817751 CACGTTTACCATTTTTCTATTGG + Intronic
1052550467 9:29941004-29941026 CTTGCTTTCCTTTCCTCTATTGG - Intergenic
1052604135 9:30677105-30677127 GTTGTTTTCCATTTCTATCTTGG - Intergenic
1053601786 9:39618309-39618331 CTGGTTTTCCATTTGCCTGTGGG + Intergenic
1053636955 9:40018433-40018455 TTACTTAGCCATTTCTCTATTGG - Intergenic
1053769074 9:41446469-41446491 TTACTTAGCCATTTCTCTATTGG + Intergenic
1053859438 9:42372076-42372098 CTGGTTTTCCATTTGCCTGTGGG + Intergenic
1054251749 9:62724118-62724140 CTGGTTTTCCATTTGCCTGTGGG - Intergenic
1054317784 9:63615226-63615248 TTACTTAGCCATTTCTCTATTGG - Intergenic
1054547745 9:66357970-66357992 TTACTTAGCCATTTCTCTATTGG + Intergenic
1054565861 9:66758635-66758657 CTGGTTTTCCATTTGCCTGTGGG - Intergenic
1054866642 9:70009306-70009328 CTAGTTTTGCAACTCTCTCTGGG + Intergenic
1055176670 9:73326505-73326527 GTATTTTTACATTTGTCTATGGG + Intergenic
1055224480 9:73977911-73977933 CTAGTGTTCTATTTGTCTTTTGG - Intergenic
1057617905 9:96608531-96608553 CTAATTTTCCATTCTTTTATGGG - Intronic
1057876888 9:98763767-98763789 CTCCTTTTTCATTCCTCTATTGG - Intronic
1202784819 9_KI270719v1_random:2023-2045 TTACTTAGCCATTTCTCTATTGG - Intergenic
1185574739 X:1162417-1162439 CTAATTTTACATTTCTTTTTCGG - Intergenic
1185914915 X:4025123-4025145 TTAGATTTGCATTTCCCTATTGG - Intergenic
1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG + Exonic
1186579377 X:10800917-10800939 CTAGTTTTACATCTCTATTTAGG - Intronic
1186972693 X:14865422-14865444 CTTGTTTTCCAGTTGTCTAAAGG - Exonic
1187587718 X:20682456-20682478 ATAGTTTTTCTTTTCTTTATTGG - Intergenic
1188220914 X:27540643-27540665 CTAGTGTTCTATATCACTATAGG + Intergenic
1188401684 X:29753329-29753351 TCAGTTTTCCATGTCTCTGTAGG - Intronic
1188583592 X:31745476-31745498 TTAATTTTCCATTTCTTTCTTGG - Intronic
1188722069 X:33534466-33534488 CTAGTTTCCCTTTTCTCAAGAGG - Intergenic
1188845130 X:35062813-35062835 CTGGTTTTCCATATGTCTAATGG + Intergenic
1188902192 X:35747237-35747259 CTAGTGTTCTATATCACTATAGG - Intergenic
1188962748 X:36512771-36512793 CTAGTTTTCAATTTATCAAAGGG + Intergenic
1189411313 X:40774648-40774670 CTAGTTTTACACTTTTCTACAGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190095460 X:47476584-47476606 TTTGATTTCCATTTCTCTAGTGG - Intronic
1190394205 X:49963305-49963327 CTAGTTTTCCATTACTATGATGG - Intronic
1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG + Intronic
1190893185 X:54589318-54589340 CTATTTTTCCATCTGTTTATAGG - Intergenic
1190922598 X:54870231-54870253 ATAGATCTCCATTTCTTTATGGG + Intergenic
1192637910 X:72837463-72837485 ATAATTTTCCATTTGTCTAATGG - Intronic
1192643804 X:72883352-72883374 ATAATTTTCCATTTGTCTAATGG + Intronic
1192820018 X:74635876-74635898 TTAGTTTTCCATTGTTGTATAGG + Intergenic
1193209438 X:78788678-78788700 CAGGTTTTGCATTTCTTTATAGG + Intergenic
1194296907 X:92137276-92137298 CTATGTTTCCATTATTCTATAGG - Intronic
1194681563 X:96860396-96860418 CAAATTTTGCATTTCTCAATTGG - Intronic
1196123760 X:112078487-112078509 CTAGACTTCAATTTCTCTATAGG + Intronic
1197117600 X:122851589-122851611 CTAGTGTTCCATTTCTCCCTGGG - Intergenic
1197324242 X:125072248-125072270 CTGGTTTTCCTTTCCTTTATTGG + Intergenic
1197577075 X:128227657-128227679 TTCTTTATCCATTTCTCTATTGG - Intergenic
1197621154 X:128750803-128750825 TTTGTTTTGCATTTCTCTAATGG - Intergenic
1198003541 X:132466672-132466694 GTAGTATGCCATTTCTTTATGGG + Intronic
1198005055 X:132484683-132484705 CCAGGTTGCCTTTTCTCTATGGG + Intronic
1199916401 X:152346185-152346207 ATAGTTTTCCCTTTCCCCATAGG - Intronic
1200419938 Y:2954258-2954280 CTAGTTTTCTATTTTTCTATTGG + Intronic
1200614420 Y:5361851-5361873 CTATGTTTCCATTATTCTATAGG - Intronic
1202012164 Y:20355031-20355053 CCTCTTTTCCATTTGTCTATAGG - Intergenic