ID: 1099202464

View in Genome Browser
Species Human (GRCh38)
Location 12:79691333-79691355
Sequence CTCCCGGCGCCTCCGACTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099202454_1099202464 28 Left 1099202454 12:79691282-79691304 CCTGCGAGTTAGACGGCACATTC 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1099202464 12:79691333-79691355 CTCCCGGCGCCTCCGACTCCGGG 0: 1
1: 0
2: 1
3: 26
4: 310
1099202458_1099202464 6 Left 1099202458 12:79691304-79691326 CCTGGGCTAGCAGCTTCGCGGCG 0: 1
1: 0
2: 2
3: 4
4: 58
Right 1099202464 12:79691333-79691355 CTCCCGGCGCCTCCGACTCCGGG 0: 1
1: 0
2: 1
3: 26
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099202464 Original CRISPR CTCCCGGCGCCTCCGACTCC GGG Intergenic
900595159 1:3477114-3477136 CCCCCGGCACCTCCCGCTCCCGG - Intronic
901109837 1:6785645-6785667 CGCCCGGCGCCGCCGATGCCCGG - Intronic
901133711 1:6979314-6979336 CTGCCGCCTCCTCCAACTCCTGG + Intronic
901443465 1:9293118-9293140 CCCCCCGCGCCTCCCCCTCCCGG - Intronic
901494180 1:9612025-9612047 CACCCGGCGCCTCTGAATCCAGG + Intronic
901763742 1:11487247-11487269 CCCCAGGCTCCTCCGACTCAGGG - Intronic
902518671 1:17003481-17003503 CTCACTGCACCTCCGCCTCCTGG - Intronic
903090527 1:20911485-20911507 CTCCCTGCAACTCCAACTCCTGG - Intronic
903413959 1:23168735-23168757 CTCCCGCCGCCGCCGCCTCACGG + Intronic
905137132 1:35808366-35808388 TCCCCGGCGCCTCCCGCTCCGGG - Exonic
905173930 1:36124941-36124963 GGGCCGGCGCCTCGGACTCCGGG - Intronic
906224464 1:44109979-44110001 CTCACTGCACCTCCGCCTCCCGG + Intergenic
906624092 1:47310920-47310942 CTCACTGCACCTCCGCCTCCTGG + Intronic
911872785 1:103120280-103120302 CTCACTGCACCTCCGCCTCCTGG + Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912796907 1:112698922-112698944 CTCCCTGAGCCTCTCACTCCTGG + Intronic
912911059 1:113759414-113759436 CTGCCGCCGCCTCCTCCTCCCGG - Exonic
913644980 1:120847340-120847362 CTCACTGCACCTCCGCCTCCTGG + Intergenic
913653741 1:120942262-120942284 CTCCCGCCGGCTCCGACAGCTGG + Intergenic
913656565 1:120966039-120966061 CTCACTGCACCTCTGACTCCCGG - Intergenic
914176655 1:145284745-145284767 CTCACTGCACCTCCGCCTCCTGG - Intergenic
914259357 1:145985840-145985862 CTCACTGCACCTCCGCCTCCCGG - Intergenic
914531382 1:148526224-148526246 CTCACTGCACCTCCGCCTCCGGG - Intergenic
914637010 1:149561516-149561538 CTCACTGCACCTCCGCCTCCTGG + Intergenic
914646526 1:149657768-149657790 CTCACTGCACCTCTGACTCCCGG - Intergenic
915455563 1:156038300-156038322 CTCACTGCACCTCCGCCTCCCGG - Intronic
915623836 1:157102483-157102505 ATCCTGGCACCTCCCACTCCTGG + Intergenic
918282853 1:183023235-183023257 CTCCCGCCCCCGCCGCCTCCTGG + Intergenic
918854185 1:189729607-189729629 TTCCTGATGCCTCCGACTCCAGG - Intergenic
920731446 1:208488938-208488960 CTCTCGGCGCCTCCTATGCCTGG - Intergenic
921856597 1:219992850-219992872 ATCTTGGCGCCTCCGCCTCCTGG - Intronic
922586392 1:226737508-226737530 CCGCCGGCGCCTCCTCCTCCCGG + Exonic
922958589 1:229625910-229625932 CCCCCGCCGCCGCCGCCTCCGGG + Exonic
923724651 1:236495579-236495601 CTCGAGGCCCCTCCCACTCCCGG + Intergenic
924520294 1:244800350-244800372 CTCACTGCACCTCCAACTCCTGG - Intergenic
924740566 1:246792143-246792165 CTCCCCGGGCCACCTACTCCAGG - Intergenic
924775320 1:247111797-247111819 TCCCCGGCGCCTCCGCCTGCAGG - Exonic
1063429544 10:5977202-5977224 CTCCCTGCGACCCCGGCTCCCGG + Intronic
1064748991 10:18506871-18506893 CTCACTGCGCCTCTGCCTCCAGG + Intronic
1065773596 10:29099962-29099984 CTCACTGCGCCTCAAACTCCTGG + Intergenic
1066987134 10:42477449-42477471 CTGCCGGCACCCCAGACTCCCGG - Intergenic
1070015537 10:72526368-72526390 CTCACTGCACCTCCGCCTCCCGG + Intronic
1070591483 10:77805042-77805064 CTCACTGCACCTCCGCCTCCTGG + Intronic
1072131522 10:92498680-92498702 CTCACTGCACCTCCGCCTCCCGG - Intronic
1072138606 10:92571052-92571074 CTCACTGCACCTCCGCCTCCTGG + Intronic
1072339804 10:94436208-94436230 CTCACTGCACCTCCGCCTCCTGG + Intronic
1073019747 10:100433041-100433063 CTCACGGCAACCCCGACTCCCGG - Intergenic
1073412108 10:103350887-103350909 CTCCCGGCTGCTCCGGCTCCCGG - Exonic
1073498815 10:103918109-103918131 CTCCCGCCGCCTGCAGCTCCAGG + Exonic
1075124147 10:119686348-119686370 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1075307619 10:121382244-121382266 CTCCCCGCAGCTCCGAGTCCAGG - Intergenic
1077475971 11:2790658-2790680 CTCTCAGCGCCTCAGCCTCCTGG + Intronic
1078225906 11:9391322-9391344 CTCACTGCACCTCCGCCTCCCGG - Intronic
1081901725 11:46634470-46634492 CTCACTGCACCTCCGCCTCCCGG + Intronic
1083434606 11:62633868-62633890 CTCCCTGGGCCTCAGCCTCCTGG + Intronic
1083659780 11:64246709-64246731 CTCCCTGCGCCACCGCCTCCGGG + Exonic
1083901745 11:65646710-65646732 CGCCCGGCGCCTCCCACCCAGGG - Exonic
1084076425 11:66781609-66781631 CTCCTGCAGCCTCCAACTCCTGG + Intronic
1084129210 11:67119838-67119860 CTCCTGACGCCTCCGACTCCCGG + Exonic
1084633178 11:70370024-70370046 CTCACTGCACCTCCGCCTCCTGG + Intronic
1084860666 11:72015846-72015868 CTCCCAGGGCCTCCGCCACCAGG - Exonic
1085782677 11:79423661-79423683 CTCCCTGCGCCTGCTGCTCCAGG - Intronic
1088480714 11:110294318-110294340 CTCACTGCACCTCCGCCTCCTGG - Intronic
1089458969 11:118641687-118641709 CTCCCTGGGCCTCCGCCTCCCGG + Intronic
1090383582 11:126343692-126343714 GTCCTGGCCCCTCCTACTCCAGG + Intronic
1091891753 12:4060896-4060918 CACTCGGTGCCTCCTACTCCTGG - Intergenic
1092732740 12:11549651-11549673 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1096365777 12:51027099-51027121 CTCACTGCACCTCCGCCTCCCGG - Intronic
1096788510 12:54031234-54031256 CGCCCCCCGCCTCCAACTCCCGG - Intronic
1096992638 12:55817730-55817752 CACCCGCGGCCTCCGCCTCCAGG + Exonic
1097007860 12:55931938-55931960 CGCCCGGCGCCCCCGACTCTGGG - Intronic
1098288469 12:68933075-68933097 CTCCTGGCGCCTCCGCCGTCCGG + Intronic
1098923776 12:76327149-76327171 CTCTCTGCACCTCCGCCTCCTGG - Intergenic
1099202464 12:79691333-79691355 CTCCCGGCGCCTCCGACTCCGGG + Intergenic
1101090536 12:101280400-101280422 CTCCAGGGGCCTCAGACTTCTGG + Intronic
1101466798 12:104957968-104957990 CTCCCCGCGCCCCCGCCGCCGGG + Intronic
1102061482 12:109935474-109935496 CTCCTGGCTTCTCCGCCTCCCGG + Intronic
1102244582 12:111347520-111347542 CTCCCGGCGCATCCGGGACCTGG - Exonic
1102519936 12:113471808-113471830 GTGCCGGCGCCTCCGCCACCGGG - Exonic
1102766828 12:115440634-115440656 CTCCCAGGTCCTCCGGCTCCAGG + Intergenic
1103130615 12:118465235-118465257 CTCACAGCACCTCCGCCTCCCGG - Intergenic
1103507859 12:121453696-121453718 TTCCCCGCGCCTCCAGCTCCTGG - Intronic
1103621568 12:122190205-122190227 CCTCCGGCACCTGCGACTCCTGG + Exonic
1105437268 13:20390059-20390081 CTCCAGGAGCCCCCCACTCCAGG - Intergenic
1108641224 13:52384108-52384130 CTCACGGCAACTCCGCCTCCCGG - Intronic
1110400671 13:75087609-75087631 CTCCCCACTCCTCCCACTCCTGG - Intergenic
1110815096 13:79852446-79852468 CTCACTGCACCTCCGTCTCCCGG - Intergenic
1112114621 13:96338609-96338631 CTCCCGGTGCCTCGAATTCCTGG + Intronic
1113485549 13:110650009-110650031 CTCACTGCACCTCCGCCTCCTGG + Intronic
1113950774 13:114069869-114069891 CTCCCGGCCCCTGAGTCTCCTGG - Intronic
1114452592 14:22836948-22836970 CTCCCGGCGGGCGCGACTCCGGG - Intronic
1114736744 14:25050079-25050101 CTCCCGGCAACTCCAACTCCGGG + Exonic
1115365559 14:32553234-32553256 CTCACTGCACCTCCGCCTCCTGG + Intronic
1116607064 14:47013868-47013890 CTCACTGCACCTCCGCCTCCTGG + Intronic
1116958049 14:50944104-50944126 CGGCCGGAGACTCCGACTCCGGG + Intronic
1117449743 14:55839369-55839391 CTCTCGGCGCCTCCGCTGCCTGG + Intergenic
1118137518 14:63045659-63045681 TTCCCCGCGCCTTCGTCTCCCGG + Intronic
1118380783 14:65215867-65215889 CTGCTGCCGCCTCCAACTCCTGG + Intergenic
1121568395 14:94927849-94927871 CTCCTGGAGCCTCCGTATCCTGG + Intergenic
1121645772 14:95516471-95516493 CTTTCGGCGCCCCCGATTCCCGG + Intronic
1122523461 14:102363150-102363172 CCCCCGACGCCCCCGACGCCTGG + Intronic
1122666417 14:103333690-103333712 CTCCCGGGACGCCCGACTCCGGG - Intronic
1122905791 14:104800872-104800894 CTCGCGGCGTCCCCGACGCCCGG - Intronic
1122982105 14:105196587-105196609 CTGCCGTCGCCTCTGACCCCAGG + Intergenic
1202848622 14_GL000225v1_random:1755-1777 CTCCCGGGGCCTCCGTTTCTAGG - Intergenic
1123676004 15:22710792-22710814 CTCCCCGGGCCTCCGCCTCCCGG + Intergenic
1123734781 15:23175141-23175163 CTCGCCGGGCCTCCGCCTCCCGG - Intergenic
1124146968 15:27136886-27136908 CTCCTGTCGCCCCCGCCTCCAGG + Intronic
1124285283 15:28396443-28396465 CTCGCCGGGCCTCCGCCTCCCGG - Intergenic
1124297413 15:28515183-28515205 CTCGCCGGGCCTCCGCCTCCCGG + Intergenic
1124318577 15:28693833-28693855 CTCACTGGGCCTCCGCCTCCTGG + Intergenic
1124328206 15:28784707-28784729 CTTCCCGGGCCTCCGCCTCCCGG + Intergenic
1125664911 15:41422847-41422869 CTCCTGCAGCCTCCGCCTCCCGG + Intronic
1127262155 15:57334481-57334503 CTCCCGGCTCCTCCCTCTCCTGG - Intergenic
1128263878 15:66252134-66252156 AATCCGGCCCCTCCGACTCCGGG + Intronic
1130963491 15:88680718-88680740 CTGCCTGCCCCTCCGTCTCCTGG - Intergenic
1131257333 15:90871419-90871441 CGCCCGCTGCCTCCGGCTCCTGG - Intronic
1132618989 16:855538-855560 CTCCTGGCGCCTCCTCCTCCGGG - Intronic
1132680734 16:1140701-1140723 AGCCCGGCGCCTCCTTCTCCTGG + Intergenic
1133181436 16:4057729-4057751 CTCCCCGGGCCTCCGCTTCCTGG - Intronic
1133440575 16:5817766-5817788 CTCACTGCAGCTCCGACTCCCGG + Intergenic
1133596466 16:7298361-7298383 CTACCGCAGCCTCCGCCTCCTGG + Intronic
1133791615 16:9013409-9013431 CTGCCGCCGCCTCCTCCTCCCGG - Intergenic
1134110637 16:11513503-11513525 CTCACTGCACCTCCGCCTCCCGG + Intronic
1136341748 16:29648522-29648544 CTTCCGGCGCCTCTGACCCGGGG - Intergenic
1139331357 16:66194433-66194455 CTCCCTGCAACTCCGCCTCCCGG + Intergenic
1142163289 16:88570510-88570532 CTCCACGCCGCTCCGACTCCAGG + Exonic
1142761905 17:2047458-2047480 CTCACTGCACCTCCGTCTCCTGG + Intergenic
1142863352 17:2776616-2776638 CTCGCCGCGCCTCCGCCACCCGG - Intergenic
1143679784 17:8467700-8467722 CTCCGTGCGCCTCAGACTCGGGG + Exonic
1144737146 17:17561563-17561585 CTCCAGGCACCACCCACTCCAGG + Intronic
1145021486 17:19435069-19435091 CTCACTGCACCTCCGCCTCCTGG + Intergenic
1146763507 17:35498168-35498190 CTCCCCACGCCGCCGCCTCCCGG - Intronic
1147284757 17:39392924-39392946 ATCTCGGCTCCTCCGCCTCCTGG - Intronic
1149113428 17:53062577-53062599 CTCACTGCGCCTCCGCCTCCCGG + Intergenic
1149759216 17:59214482-59214504 CTCACTGCACCTCCGCCTCCTGG + Intronic
1150724647 17:67641720-67641742 CTGCAGCAGCCTCCGACTCCTGG - Intronic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1152291235 17:79441267-79441289 CTCCCGGAGCCTCGGCCTGCAGG + Intronic
1153618899 18:6957853-6957875 CTCACTGCACCTCCGCCTCCCGG + Intronic
1154368359 18:13732834-13732856 CTCCCGGGACCTCCACCTCCCGG + Intronic
1154500996 18:14998057-14998079 CTCCCGGGGCCGCGGGCTCCTGG + Intergenic
1156099816 18:33579052-33579074 CTCCCGGCCCCTCCACCCCCCGG + Intronic
1157248202 18:46071890-46071912 GTCCCGGGGGCTCGGACTCCAGG - Intronic
1157776723 18:50402005-50402027 CTCCCGGCTCCTGCGCCTTCAGG + Intergenic
1157794312 18:50560273-50560295 CTCCCGCCGCCTGCGCCTCTCGG + Intronic
1158985221 18:62808624-62808646 CTCACTGCACCTCCGCCTCCTGG + Intronic
1160733777 19:652695-652717 CTCCCGGAGCCACAGACACCAGG + Intronic
1160763921 19:798692-798714 CTCCCGGCCACTGCAACTCCCGG - Intronic
1160847626 19:1173490-1173512 CTCCCCGCCCCTCCCGCTCCTGG - Intronic
1160933218 19:1580546-1580568 CTGCAGGCGCCTCCGTCACCAGG + Intronic
1161243110 19:3233946-3233968 CTCCAGGCGCCGCCGTCTTCAGG - Intronic
1161296536 19:3523188-3523210 CACACGGGGCCTCCGCCTCCTGG + Intronic
1161736625 19:5995656-5995678 CTGCAGGCGCCCCTGACTCCAGG - Intronic
1161739451 19:6011694-6011716 CTCCTGGAACCTCCAACTCCTGG + Intronic
1161808680 19:6459422-6459444 CTCCCGGCCCCGCCCGCTCCCGG - Intronic
1161972440 19:7590303-7590325 CTCCCGCCTCCTCCCACACCTGG - Intergenic
1162122061 19:8476883-8476905 CTCCCACCACCACCGACTCCTGG + Intronic
1163030002 19:14537818-14537840 CTCGCTGCACCTCCGCCTCCCGG + Intronic
1163031086 19:14544705-14544727 CTCCCTGCAACTCCAACTCCTGG + Intronic
1164109132 19:22138088-22138110 CTCCCGGCTGCTCCGGCTCCCGG + Intergenic
1164830714 19:31317870-31317892 CTCCAGGCACCTCCCACCCCTGG + Intronic
1165107603 19:33481944-33481966 CTCACTGCACCTCCGCCTCCTGG - Intronic
1165597926 19:37026392-37026414 CTCACTGCACCTCCGCCTCCTGG + Intronic
1166216919 19:41341902-41341924 CTCCCGGCACCGCCGAGCCCTGG - Exonic
1167682430 19:50932246-50932268 CTCCCTGCTCCTCAGCCTCCTGG + Intergenic
925627098 2:5852423-5852445 CTCCCTGCACCTCCCATTCCAGG - Intergenic
926910979 2:17852305-17852327 CTCCTGGAGCCTCCTACTCCTGG - Intergenic
927145585 2:20163498-20163520 CTCACTGCACCTCCGCCTCCTGG - Intergenic
927502944 2:23594316-23594338 CTGCGGGCGCCTCAGACTTCAGG - Intronic
927763408 2:25781741-25781763 CTCACGCAGCCTCCGCCTCCTGG + Intronic
929746673 2:44666683-44666705 CTCACTGAGCCTCCGCCTCCTGG + Intronic
931317277 2:61144568-61144590 CTCACTGCACCTCCGCCTCCCGG - Intergenic
932268378 2:70387592-70387614 CTCCCAGGGCCTCAGGCTCCTGG + Intergenic
932708671 2:74046827-74046849 CTCCCAGGGCCTCTGCCTCCTGG + Exonic
933188285 2:79303327-79303349 CTCCAGGTTCCTCTGACTCCAGG + Intronic
934564239 2:95329635-95329657 CTCCCGGGTCCCCCCACTCCCGG - Intronic
935112255 2:100104610-100104632 CGCCCCCCGCCCCCGACTCCGGG + Intronic
936122727 2:109760549-109760571 CGCCCCCCGCCCCCGACTCCGGG - Intergenic
936221966 2:110610924-110610946 CGCCCCCCGCCCCCGACTCCGGG + Intergenic
938120943 2:128632620-128632642 CTCGCGGCGCCCCCCACCCCCGG + Intergenic
938500168 2:131828246-131828268 CTCCCGGGGCCGCGGGCTCCTGG + Intergenic
942444960 2:176071715-176071737 CTCCCGGAGCCACCGGCTGCTGG + Intergenic
943426791 2:187747885-187747907 CTCCCTGCTCCCCCGACCCCAGG - Intergenic
944451815 2:199851179-199851201 CTGCCGCCGGCTCCGCCTCCCGG + Intergenic
945241580 2:207681532-207681554 CTCCCTGCGCCGCCGCCTCCGGG - Intergenic
946395523 2:219442093-219442115 CTCCCGGCGCCGCCCGCCCCCGG - Intronic
946825185 2:223670613-223670635 CTCACTGCACCTCCAACTCCTGG + Intergenic
946865628 2:224039162-224039184 CTCCCCGCGCCGCCGAGACCAGG - Intronic
948824618 2:240568338-240568360 CTCCCCGCGCCCCTGGCTCCTGG + Intronic
948837042 2:240630907-240630929 CTCCCGGAGCCCCCGAGACCTGG - Exonic
1168751295 20:283782-283804 CTCCCTGCGCCTCAGTTTCCCGG + Intronic
1169065666 20:2693123-2693145 CGCCCGCAGCCTCCGCCTCCCGG + Exonic
1169136946 20:3203330-3203352 CTCTCGGCTCCTCAGGCTCCAGG + Exonic
1169244507 20:4015283-4015305 CTCCCGGCGCCTCGGCCGGCCGG - Intronic
1171457331 20:25279307-25279329 CCCCCGGAACCTCCGTCTCCTGG - Intronic
1172483331 20:35284592-35284614 CTCCCGGCCCCTCCGTCCTCGGG + Intronic
1172845353 20:37927037-37927059 CTCACTGCGCCTCCTCCTCCCGG + Intronic
1172873820 20:38152259-38152281 CTGCCGGCCCCTCAGACCCCTGG + Intronic
1173079190 20:39849880-39849902 CTCCCGGAGCCTCCGGCCCTGGG + Intergenic
1174056341 20:47800810-47800832 CTCCCTGCCCCACCCACTCCTGG - Intergenic
1174075421 20:47932043-47932065 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1174101075 20:48126603-48126625 CTCCCTGCGTCTCCAGCTCCAGG + Intergenic
1175358519 20:58389129-58389151 CGCCCTGCGCCGCCGGCTCCAGG - Exonic
1176286437 21:5021569-5021591 CTCCCGGAGCCCCCGCCTCTGGG - Intergenic
1177403621 21:20638135-20638157 CTCCCAGAGGCTCAGACTCCAGG + Intergenic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1179870744 21:44241906-44241928 CTCCCGGAGCCCCCGCCTCTGGG + Intergenic
1180622654 22:17172038-17172060 CTCCCGGCGCCTGCCAGTCCTGG - Intergenic
1181265727 22:21629619-21629641 CTCCGGCCGCCACCGCCTCCCGG + Exonic
1181585717 22:23852512-23852534 CTCCCTGAGCCTCAGTCTCCTGG + Intergenic
1181948965 22:26540728-26540750 TGCCTGGCGCCTCTGACTCCAGG + Intronic
1182572329 22:31248602-31248624 CTCCCGGCACCTCTGGCTGCAGG - Exonic
1182645090 22:31802201-31802223 CTCACTGCGCCTCTGCCTCCTGG + Intronic
1183313947 22:37127099-37127121 CTGCCTGGGCCTCGGACTCCAGG + Exonic
1184106206 22:42368829-42368851 GCCCGGGCGCCTCCGAATCCGGG - Intergenic
1184470366 22:44692421-44692443 CTCCCGGGGGCTCCTCCTCCTGG + Intronic
1184796670 22:46737216-46737238 CTCACTGCACCTCCGCCTCCTGG - Intronic
1185364675 22:50432003-50432025 CTCCCTTCTCCTCCAACTCCTGG - Intronic
1185413381 22:50697401-50697423 CTCCCCTCGCCGCCGACCCCCGG - Intergenic
951513686 3:23533695-23533717 CTCCCGCAACCTCCGCCTCCTGG + Intronic
952713236 3:36453206-36453228 CTCCCGGCGCCTCCTCTGCCTGG + Intronic
952838452 3:37624679-37624701 CTCACTGCACCTCCGCCTCCTGG + Intronic
953982166 3:47418396-47418418 CTCCCCGCGCCTCCGCCGCCCGG + Exonic
954416053 3:50393935-50393957 CTCCAGGCGCCTCTCACTGCTGG - Intronic
954912350 3:54121199-54121221 CTCCCGGCGCACCAGACACCTGG - Intergenic
955080038 3:55649938-55649960 CTGCCGGCCCCTCTGCCTCCTGG - Intronic
955280514 3:57590014-57590036 CTCACTGCGCCTCCACCTCCCGG - Intronic
955485731 3:59432980-59433002 CTCTCGGCTCCTCCTCCTCCCGG - Intergenic
956296460 3:67720060-67720082 CTCACTGCACCTCCGCCTCCTGG + Intergenic
958941232 3:100317006-100317028 CTCACTGCACCTCCGCCTCCTGG - Intronic
960223798 3:115147106-115147128 GTCCCGCCGCCCCCCACTCCAGG + Intronic
961949028 3:130727345-130727367 CTCCCGCCGCCTCCGAGTACAGG + Intronic
962130526 3:132669339-132669361 CTCACTGCACCTCCGCCTCCCGG + Intronic
964019995 3:151998595-151998617 CTCCTGGTGCCGCCGACTCACGG - Intergenic
964209297 3:154210198-154210220 CTCCTGGGGTCCCCGACTCCAGG - Intronic
965170275 3:165254071-165254093 CTCACTGCACCTCCGCCTCCAGG - Intergenic
966413307 3:179665011-179665033 CTCACTGCACCTCCGCCTCCTGG - Intronic
966866496 3:184261437-184261459 TCCCCCGCGCCTCCGCCTCCCGG + Exonic
967027607 3:185578442-185578464 CTCACCGCACCTCCGCCTCCTGG + Intergenic
967098268 3:186194680-186194702 CTCCCGGAGCTACCGAGTCCTGG - Intronic
967837210 3:193974714-193974736 CTCCCCGCTCCCCCGACGCCCGG - Intergenic
967883170 3:194315730-194315752 CTCCCGGAGGCTCCGACCCCCGG + Intergenic
968434025 4:575898-575920 CCGCCGGCGCCTTCTACTCCGGG - Intergenic
968775007 4:2535546-2535568 CTGCCGGCGGCTCCGCCCCCTGG - Intronic
968922951 4:3532114-3532136 CCCCCTCCGCCTCCGACCCCTGG + Intronic
969370248 4:6727327-6727349 CTCCCCACGCCCCCGGCTCCCGG - Intergenic
970571968 4:17392278-17392300 CTCTCTACGCCTCAGACTCCTGG - Intergenic
972845577 4:42984914-42984936 CTCCCTCAGCCTCAGACTCCAGG - Intronic
972979499 4:44678597-44678619 CTCCTGACGCCTCCGCCGCCCGG + Exonic
975743734 4:77455673-77455695 CTCCCCTAGCCCCCGACTCCTGG + Intergenic
976366774 4:84241421-84241443 CTCCCGGTGCCTCTGTCTCTGGG + Intergenic
977032517 4:91904072-91904094 CTGCCGATGCCTCAGACTCCAGG + Intergenic
977206437 4:94169702-94169724 CTCCCGGCGCCTCCTCTGCCTGG + Intergenic
979160127 4:117449040-117449062 CTCCTGGTGGCTCAGACTCCTGG - Intergenic
979930084 4:126619074-126619096 CTCACTGCACCTCCGCCTCCTGG + Intergenic
980923924 4:139115410-139115432 CTCCCTGCGCCACCGCCTCCGGG + Intronic
982202860 4:152975903-152975925 CTCCCGGGGCCTCCAAGCCCGGG + Exonic
984888995 4:184474684-184474706 CTCCCTCCGCCTCCACCTCCCGG - Intergenic
985521214 5:374687-374709 CACCCGGTGCCACCGTCTCCGGG + Intronic
985661043 5:1156508-1156530 CTCCCAGCGCCTCCGCAGCCAGG - Intergenic
985683733 5:1270968-1270990 CCCCCGCCCCCTCCGGCTCCTGG - Intronic
997451012 5:133983172-133983194 CTCACGCAGCCTCCGCCTCCCGG - Intronic
998055673 5:139074897-139074919 CTCACTGCACCTCCGCCTCCCGG + Intronic
998203927 5:140145992-140146014 CCGCCGGCTCCTCGGACTCCGGG + Intergenic
998850490 5:146346175-146346197 CTCCCGGCGCCTCCGGATAGGGG + Intergenic
999307912 5:150532599-150532621 CTCACTGCACCTCCGCCTCCCGG + Intronic
1000066795 5:157700308-157700330 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1001379032 5:171290292-171290314 CTCACTGCACCTCCGCCTCCCGG - Intronic
1002255162 5:177953181-177953203 CTCCTGGGACCTCCGCCTCCCGG + Intergenic
1002851037 6:996610-996632 CTCCCGACGCCGCTCACTCCTGG + Intergenic
1003908057 6:10720459-10720481 CTCTCGGCGCCTCCTCTTCCTGG + Intergenic
1005450347 6:25965844-25965866 CTCACTGCACCTCCGCCTCCCGG - Intronic
1005934783 6:30512557-30512579 CTCACTGCGCCTCCGCCTCCCGG - Intergenic
1005987688 6:30884583-30884605 CCGCCGGCGCCTCCCGCTCCCGG + Intronic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1007400200 6:41598900-41598922 CTCCCGGCAGCTCCTCCTCCAGG - Exonic
1007506751 6:42341485-42341507 TTCCCGGGGCCTTAGACTCCGGG - Intronic
1008026312 6:46640035-46640057 CTCACTGCGACTCCAACTCCTGG - Intronic
1010363889 6:75027417-75027439 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1013069539 6:106716129-106716151 CTCCCTGCGCCTTCAGCTCCCGG - Intergenic
1013155802 6:107490253-107490275 CTCCCGCCGCCGCCGCCGCCGGG - Exonic
1014079430 6:117270431-117270453 CGCCCGGCGCCTTCGTCTCTCGG + Intronic
1014598386 6:123374699-123374721 CTCACTGCACCTCCGCCTCCTGG - Intronic
1016517658 6:144913255-144913277 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1016975899 6:149807443-149807465 CTCACTGCACCTCCGCCTCCTGG + Intronic
1017943982 6:159078580-159078602 CTCCCCACGCCTCCCATTCCTGG - Intergenic
1019699442 7:2467220-2467242 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1020445243 7:8261712-8261734 TTCCCGGCGGCTCCGGCCCCAGG - Intronic
1021225739 7:18023744-18023766 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1022375278 7:29806600-29806622 CCGCCGCCGCCTCCGGCTCCGGG - Exonic
1023725771 7:43141571-43141593 CTCACCGCGCCTCCGCCTCCTGG + Intronic
1023903618 7:44505152-44505174 CTCCCGATGCCTGAGACTCCAGG + Intergenic
1025078893 7:55965138-55965160 CTCCCGGCACCTCAGAGACCAGG - Intronic
1025236659 7:57239344-57239366 CTCCCTGCCCCACCCACTCCTGG + Intergenic
1026522875 7:71132010-71132032 CTCACAGCGCCGCCGGCTCCCGG - Intergenic
1026744609 7:73001271-73001293 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1027030717 7:74885936-74885958 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1027099128 7:75363821-75363843 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1027121893 7:75527900-75527922 GCCCCAGCGCCGCCGACTCCGGG + Intergenic
1029120820 7:98266855-98266877 CTCCTGCAGCCTCCGTCTCCAGG - Intronic
1029400228 7:100340601-100340623 CTCACTGCACCTCCGCCTCCCGG + Intronic
1029596277 7:101539017-101539039 CTCACGGGGCCTCTGAGTCCTGG + Intronic
1032013553 7:128361609-128361631 CTCCCAGCGGCGCCGCCTCCTGG + Exonic
1035446201 7:158944848-158944870 CTCCTGGCACCTGCAACTCCAGG - Intronic
1037865697 8:22440914-22440936 CTCTCGGCTCCTCCGGCTCCGGG - Intronic
1038638203 8:29304115-29304137 CTCTCGGCGCCTCCTATGCCTGG + Intergenic
1039117775 8:34111857-34111879 CTCCTGGTCCCTCCCACTCCAGG - Intergenic
1039975719 8:42363047-42363069 CTCACCGCACCTCCGTCTCCTGG - Intronic
1040033533 8:42846752-42846774 CTCCAGCAGCCTCAGACTCCTGG - Intergenic
1041008049 8:53514898-53514920 CTCCCGGTGTCTGCGCCTCCAGG - Intergenic
1042830306 8:73019603-73019625 CTCACTGAGCCTCAGACTCCTGG + Intronic
1044245198 8:89936149-89936171 CTCACGCAGCCTCCGCCTCCTGG + Intronic
1044729781 8:95220524-95220546 CTCCCTGCTCCTCCTGCTCCTGG + Intergenic
1048484004 8:134831493-134831515 CTCCCGGCCTCTCTCACTCCCGG + Intergenic
1049198175 8:141326709-141326731 CTCCCGGAGCCTCCTTCTCCAGG + Intergenic
1049620655 8:143597107-143597129 CTCCCGGCGCCCCCGTCCCGCGG + Intronic
1051637644 9:19195409-19195431 CTCACCGCACCTCCGCCTCCTGG - Intergenic
1053055216 9:34989846-34989868 CTCCCGGGACCCCCGAGTCCTGG - Intronic
1057062803 9:92020508-92020530 CTCCCCGCGTCCCCCACTCCCGG + Intergenic
1057469904 9:95348329-95348351 CTCCCTGCACCTCTGCCTCCTGG - Intergenic
1057477060 9:95411786-95411808 CTCACGGTCCCTCCGCCTCCAGG - Intergenic
1057868810 9:98702422-98702444 TTCCCAGCCCCTCCGACTCCAGG + Intronic
1059163088 9:112053438-112053460 CTCACTGCACCTCCGCCTCCTGG - Intronic
1059440459 9:114303898-114303920 CTCCCGAAGCTTCTGACTCCAGG - Intronic
1060301048 9:122374843-122374865 CTCCCTCCTCCTCCTACTCCTGG - Intronic
1060904696 9:127294376-127294398 CTCACTGCACCTCCGCCTCCTGG + Intronic
1061222142 9:129258495-129258517 CTCCCGGCCCCTCCTGCTCCGGG + Intergenic
1061402914 9:130378270-130378292 CTCCCAGCTTCTCTGACTCCCGG - Intronic
1061417022 9:130452563-130452585 CTCCCCGCGCCTCCATCACCTGG - Intronic
1061517271 9:131097013-131097035 GCCCCGTCGCCTCCGACTCCAGG + Intronic
1062413693 9:136437511-136437533 CTCCCGCTGCCTCCCGCTCCTGG - Intronic
1062696198 9:137877612-137877634 CGCCCCGCGCCTCCCACCCCGGG - Intergenic
1187077153 X:15946887-15946909 CTTCTGGCACCTCTGACTCCAGG + Intergenic
1191022424 X:55877172-55877194 CTCACTGAGCCTCCAACTCCTGG + Intergenic
1195577475 X:106467715-106467737 CTCCCAGATCCTCCCACTCCCGG + Intergenic
1197846601 X:130810512-130810534 CTCCTGAAGCCTCAGACTCCAGG + Intronic
1201371926 Y:13274706-13274728 CTCACCGCACCTCCGATTCCTGG - Intronic