ID: 1099202467

View in Genome Browser
Species Human (GRCh38)
Location 12:79691336-79691358
Sequence CGCCCCGGAGTCGGAGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099202467 Original CRISPR CGCCCCGGAGTCGGAGGCGC CGG (reversed) Intergenic
900116993 1:1033183-1033205 CGCGCGGGAGTCGGGGGCGCCGG + Intronic
900498067 1:2985385-2985407 CTCCCCGGAGGCTGAGGGGCCGG - Intergenic
901443461 1:9293115-9293137 GGCCCGGGAGGGGGAGGCGCGGG + Intronic
903907595 1:26697167-26697189 CGACGAGGAGGCGGAGGCGCTGG - Exonic
904237051 1:29122823-29122845 CGGCCCGGATCCCGAGGCGCAGG - Intronic
904257119 1:29260840-29260862 CGTCCCGGAGACGGCGGCACTGG + Exonic
904720082 1:32500892-32500914 CTCCCCGGAGTCCGCCGCGCCGG - Intronic
905137104 1:35808279-35808301 CGCCGCGGAGACGCGGGCGCTGG - Exonic
905137129 1:35808363-35808385 GGGCCCGGAGCGGGAGGCGCCGG + Exonic
905173928 1:36124938-36124960 CACCCCGGAGTCCGAGGCGCCGG + Intronic
906518437 1:46453160-46453182 CGGCCCGGTGACGGAGGCGCAGG - Intergenic
912174645 1:107141119-107141141 CCCCCCGGGGGCGGAGGCGAAGG + Exonic
913231166 1:116741863-116741885 CGCCTCGCAGGCGCAGGCGCAGG - Intergenic
915247605 1:154567754-154567776 CGCCCCGGAGGCGGAAACGCTGG - Intergenic
916606058 1:166343314-166343336 GGCCCCGCACTCGGAGGGGCCGG - Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918044919 1:180935841-180935863 AGCCCCGCAGTCGCAGTCGCGGG - Exonic
921179338 1:212619351-212619373 CCCCCAGGAGTCGGAGAAGCTGG + Exonic
924948056 1:248858952-248858974 GGCCCGGGAGGCGCAGGCGCAGG - Intronic
1065099768 10:22321408-22321430 GGCCCCGGAGGAGGAGGCGTTGG + Exonic
1069280858 10:66651745-66651767 GGCCCCGCACTCGGAGCCGCAGG - Intronic
1070314209 10:75295160-75295182 GCCCCCCGAGTCGGAGTCGCGGG - Intergenic
1076146389 10:128125928-128125950 CTCCCAGGAGGCGCAGGCGCTGG - Intronic
1076890702 10:133281832-133281854 CACCCCGGAGCCGGCGCCGCAGG + Intronic
1082986135 11:59172502-59172524 AGGCCCGGAGGCGGCGGCGCAGG + Exonic
1083659782 11:64246712-64246734 CGTCCCGGAGGCGGTGGCGCAGG - Exonic
1084265639 11:68003917-68003939 GGACCCGGAGTGCGAGGCGCGGG - Intronic
1089432568 11:118436297-118436319 CGCCCAGGCGTCAGAGGCGGAGG + Intergenic
1089966302 11:122656731-122656753 CCCCCTGGAGTAGGAGGAGCGGG + Intronic
1091550370 12:1531198-1531220 GGCTCCGGGGTCGGCGGCGCAGG + Intronic
1092221381 12:6716115-6716137 CGCCCTGCACTCGGAGGAGCCGG + Intergenic
1094175980 12:27541830-27541852 AGCCCTGGAGTCGGAAGCTCTGG - Intronic
1094703922 12:32896787-32896809 CGCCACGGAGCTGGGGGCGCTGG + Intronic
1095812132 12:46383077-46383099 CGCCCCAGAGGCGAAGGCGGAGG + Intergenic
1096788507 12:54031231-54031253 CTCCCGGGAGTTGGAGGCGGGGG + Intronic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1099716251 12:86296684-86296706 GGCCCCGCACTCGGAGCCGCTGG - Intronic
1101592938 12:106139325-106139347 GGCCCCGGAGCCCGAGGCGGCGG - Exonic
1102310672 12:111842316-111842338 GGCGGCGGAGGCGGAGGCGCAGG + Intronic
1102519934 12:113471805-113471827 TTCCCCGGTGGCGGAGGCGCCGG + Exonic
1105349417 13:19602172-19602194 CTCCCCGCAGCTGGAGGCGCCGG - Intergenic
1105801088 13:23903727-23903749 CTCCCCTGGGGCGGAGGCGCGGG - Intergenic
1114069838 14:19097928-19097950 CGCCCCGTGGCCGGAGCCGCAGG - Intergenic
1116958050 14:50944107-50944129 CAGCCCGGAGTCGGAGTCTCCGG - Intronic
1122859404 14:104575814-104575836 CGGCCCGGAGTGGGAGGTCCAGG - Intronic
1126152262 15:45533842-45533864 AGCCCCAGAGTCTGAGGCGGTGG + Intergenic
1127165589 15:56243202-56243224 CACCCCCGAGTTGGGGGCGCTGG + Exonic
1128263879 15:66252137-66252159 GTTCCCGGAGTCGGAGGGGCCGG - Intronic
1132683564 16:1153321-1153343 CGGGCCGGGGGCGGAGGCGCTGG + Exonic
1132747675 16:1443732-1443754 CGCCGTGGAGGCGGAGGCGGCGG + Intronic
1136341746 16:29648519-29648541 GGCCCCCGGGTCAGAGGCGCCGG + Intergenic
1136933511 16:34437886-34437908 CGCTCCGCAGTCAGCGGCGCCGG - Intergenic
1136971061 16:34973928-34973950 CGCTCCGCAGTCAGCGGCGCCGG + Intergenic
1140422563 16:74832615-74832637 CTCCCCGGAGTCAGATGAGCAGG + Intergenic
1140481739 16:75265940-75265962 CGCTCAGGAGCCGGAGGAGCCGG - Exonic
1142204149 16:88774784-88774806 CACCCCGGAGCCGGCTGCGCAGG + Intronic
1142240230 16:88941506-88941528 CGCCCCGGTGGCGGAGGCGTTGG - Intronic
1142292937 16:89201125-89201147 CGCCCCGGAGCAGGAAGCCCAGG + Exonic
1142863410 17:2776818-2776840 CGCCCCGGAGGAGGAGGAGGAGG + Intergenic
1143148264 17:4790182-4790204 AGCCACCGAGGCGGAGGCGCGGG + Exonic
1144339969 17:14302680-14302702 CGCCCGCCAGGCGGAGGCGCCGG - Intronic
1146773135 17:35587411-35587433 CTCACCGGAGGCGGAGGCGAAGG - Exonic
1147285772 17:39401715-39401737 CGCCCGGGAGGGGGAGGGGCGGG + Intronic
1148462771 17:47847823-47847845 CGCCCCGGAGTCTCAAGGGCTGG - Exonic
1148786740 17:50149442-50149464 GGCCCCGGAGAAGGAGGCGGCGG - Exonic
1149430558 17:56593493-56593515 CGCCGCGGAGGCGGCGGCGGCGG - Intergenic
1151801981 17:76384276-76384298 CGCAGCGCAGACGGAGGCGCGGG - Intronic
1152222196 17:79075016-79075038 GGCCCCGGAGGCGGGGACGCAGG + Exonic
1160204465 18:76822175-76822197 CGCCCGGGCCACGGAGGCGCGGG + Exonic
1160255975 18:77249609-77249631 CGCGCCGGGGTGGGAGGCGGAGG - Intergenic
1163020656 19:14479432-14479454 GGCCCCGGGATCGGAGCCGCAGG + Exonic
1167234977 19:48308900-48308922 CTCCCTGGAGTGGGAGGCCCGGG - Intronic
926020449 2:9490439-9490461 CGGCCTGGAGTCTGGGGCGCAGG + Exonic
927702387 2:25276635-25276657 CGCCCCGGAGGCTGCGGGGCTGG + Intronic
929857901 2:45651432-45651454 CGCCCAGGAGGCGGCGGCCCCGG + Intronic
932239077 2:70142856-70142878 CCCCCCGGAAGCGGCGGCGCGGG + Intergenic
934661237 2:96144776-96144798 AGCCCTGGAGTCGGAGCGGCTGG + Exonic
935112257 2:100104613-100104635 CGGCCCGGAGTCGGGGGCGGGGG - Intronic
936122725 2:109760546-109760568 CGGCCCGGAGTCGGGGGCGGGGG + Intergenic
936221968 2:110610927-110610949 CGGCCCGGAGTCGGGGGCGGGGG - Intergenic
937181118 2:119997062-119997084 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
943222819 2:185132678-185132700 GGCCCCGGACTCGGAGCAGCCGG + Intergenic
945241578 2:207681529-207681551 CGTCCCGGAGGCGGCGGCGCAGG + Intergenic
945988164 2:216371440-216371462 CGACCCGGAGCCGGAGGAGGAGG - Exonic
946094957 2:217266167-217266189 TGACCAGGAGTCGGAGGCTCAGG - Intergenic
946414022 2:219530318-219530340 CGCCCCGGAGATGGAAGCCCAGG - Intronic
1170150298 20:13221070-13221092 CGCCCCGCACTCGGAGTCCCGGG - Intergenic
1172201738 20:33131834-33131856 CTCCCTGGAGGTGGAGGCGCTGG + Intergenic
1172742405 20:37179320-37179342 CCCGCCGGAGTCCGAGCCGCGGG - Exonic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1173741656 20:45406392-45406414 CGCACCGGCGTCGGTGGCGAGGG + Intronic
1173913599 20:46689348-46689370 CGCCCCGGAGGCTGAGGCTCTGG - Exonic
1174607041 20:51768465-51768487 CGCCCCGGGGGAGGAGGCGGCGG + Exonic
1174804680 20:53594447-53594469 CGTCCCGGAGGCGGAGTCGGCGG - Intronic
1178680518 21:34669589-34669611 GGGCCCGGAGGCCGAGGCGCGGG + Exonic
1181583793 22:23842134-23842156 CGCCCAGGCGTCAGAGGCCCTGG - Intergenic
1182532381 22:30969862-30969884 AGCTCCGGAGTCGGAAGAGCTGG + Intergenic
1183201477 22:36388007-36388029 CGCCCCGCCCTCGGAGCCGCGGG + Exonic
1183730104 22:39613718-39613740 CGCTCCCGAGCCGGAGGCGCTGG + Intronic
1184143267 22:42592192-42592214 CTCCCCGCAGTCTCAGGCGCAGG - Intronic
1185055203 22:48575678-48575700 GGCCGCGGCGGCGGAGGCGCGGG + Intronic
1203238468 22_KI270732v1_random:30915-30937 CGCCCCGGCGGCGGCGGCGGCGG - Intergenic
950168054 3:10816316-10816338 GGCGCGGGAGTCCGAGGCGCCGG + Exonic
951016929 3:17742220-17742242 CGCCTCGGAGTCGGCGTCGGGGG - Intronic
951485223 3:23202995-23203017 CGCGCCGGAGGAGGAGGGGCGGG + Intergenic
953055338 3:39383466-39383488 AGCCGCGGAGTCTGCGGCGCGGG + Exonic
953982169 3:47418399-47418421 GGCCCGGGCGGCGGAGGCGCGGG - Exonic
961377436 3:126476063-126476085 GGCGCCGGAGGCGGAGGCGGGGG + Intergenic
963038507 3:141051889-141051911 CGCCCCTGAGTGGGCGGCGGCGG + Exonic
966866500 3:184261440-184261462 GGCCCGGGAGGCGGAGGCGCGGG - Exonic
968235797 3:197029545-197029567 TGCCCCGGAGCCGCAGGCTCAGG + Intronic
968341603 3:197960292-197960314 CGGGCCGGAGCCGGTGGCGCTGG + Exonic
968434024 4:575895-575917 CAGCCCGGAGTAGAAGGCGCCGG + Intergenic
968805284 4:2767985-2768007 AGCCCCGGAGTGGGAGGGCCTGG + Intergenic
968922955 4:3532117-3532139 GGCCCAGGGGTCGGAGGCGGAGG - Intronic
970615775 4:17767088-17767110 GGCCCCGCACTCGGAGGGGCCGG - Intronic
971457808 4:26860792-26860814 CGCCGCGGCGGCGGCGGCGCGGG + Intronic
977206498 4:94169924-94169946 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
977750984 4:100609046-100609068 GGCCCCGCACTCGGAGCCGCCGG - Intronic
979205561 4:118033602-118033624 CGCCCGGGAGGCGGTGGCGAGGG + Intronic
980698732 4:136395425-136395447 CGCCCCAGACTCGGAGCAGCTGG + Intergenic
980923926 4:139115413-139115435 CGTCCCGGAGGCGGTGGCGCAGG - Intronic
985451305 4:190065369-190065391 CGCCCCGGCTCCGGAGGAGCCGG - Intergenic
985528737 5:421398-421420 CGGCCCGGACTCAGAGGCACAGG + Intronic
994239854 5:97407258-97407280 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
994367135 5:98928940-98928962 CGCGCGGGAGGCGGAGGCGACGG - Exonic
996978280 5:129460327-129460349 CGCCCCGGAGTGGATCGCGCTGG + Exonic
998510910 5:142713307-142713329 CACCCCGGACACGGAGACGCGGG + Intergenic
998583617 5:143404199-143404221 CGGCCCGGCGGCGGCGGCGCGGG - Intronic
1000024615 5:157347882-157347904 GGCCCCAGACTCGGAGGCGGAGG + Intronic
1001704044 5:173729050-173729072 CACCCCGGAGTAGGAGTGGCAGG - Intergenic
1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG + Exonic
1002524342 5:179806968-179806990 CGCCGCGGAGTCGACGGCGCAGG + Intronic
1003498729 6:6686994-6687016 AGCCCCGGAGGAGGAGGCCCAGG - Intergenic
1004179029 6:13365081-13365103 CGCCCCGGAGCAGGAGCTGCTGG - Exonic
1004248441 6:14002507-14002529 GGCCCCGCAGTCGGAGCGGCCGG + Intergenic
1004660623 6:17706398-17706420 CGCCCCGGAGCGGGAAGCGGCGG - Exonic
1004906195 6:20239143-20239165 CGCCCCACAGTCGGAGCGGCCGG + Intergenic
1006071260 6:31499209-31499231 ACCCCCGGAGCCGGAGGCGAGGG - Intronic
1007506748 6:42341482-42341504 TGCCCCGGAGTCTAAGGCCCCGG + Intronic
1007902047 6:45422032-45422054 CGCCGCGGAGGCGGCGGCGCGGG + Intronic
1014079433 6:117270434-117270456 CGCCCGAGAGACGAAGGCGCCGG - Intronic
1015402069 6:132798444-132798466 CGCACCGGGGATGGAGGCGCTGG - Exonic
1019475257 7:1241341-1241363 CGCCCCGGAGTCGCAGCGGCGGG - Intergenic
1020008267 7:4793608-4793630 GGCCCCGCACTCGGAGCCGCCGG + Intronic
1020046704 7:5046056-5046078 AGCCCCGGAGCCGGCGGCGCTGG + Exonic
1021452783 7:20798075-20798097 GGCGCGGGAGGCGGAGGCGCAGG + Intergenic
1025015469 7:55435681-55435703 CTCCCCAGAGGCTGAGGCGCAGG + Intergenic
1026522990 7:71132431-71132453 GGCCTCGGAGTCCGCGGCGCCGG + Exonic
1026968559 7:74454627-74454649 CGCCTGGGAGTTGGGGGCGCGGG - Intronic
1027116571 7:75486082-75486104 AACCCCGGAGCCGGCGGCGCTGG - Exonic
1027121897 7:75527903-75527925 AGCCCCGGAGTCGGCGGCGCTGG - Intergenic
1027275230 7:76549528-76549550 AACCCCGGAGCCGGCGGCGCTGG + Intergenic
1028373432 7:90119633-90119655 CGCCCCGGAGCCGGAGGTAGAGG + Intergenic
1029720939 7:102364078-102364100 AACCCCGGAGCCGGCGGCGCTGG + Exonic
1032437100 7:131909407-131909429 GGCCCCGCACTCGGAGGGGCCGG + Intergenic
1033312442 7:140271585-140271607 GGCCCCGCACTCGGAGGGGCCGG - Intergenic
1033587269 7:142783358-142783380 CGCCCCCGACACAGAGGCGCAGG + Intergenic
1034446085 7:151115013-151115035 GGCCCCGGCGGCCGAGGCGCGGG - Intronic
1035167860 7:157002420-157002442 CGCCCCCCAGACGGAGGCCCAGG - Intronic
1037263863 8:17037098-17037120 GGCCCCGCAGTCGGAGCAGCCGG - Intronic
1037750713 8:21680361-21680383 CTCCCCAGAGGCGGAGGAGCTGG + Intergenic
1042926943 8:73976376-73976398 CGCCCGGGAGACAGAGGCCCGGG - Exonic
1042948776 8:74179797-74179819 GGCCCCGCACTCGGAGCCGCTGG - Intergenic
1043929033 8:86069525-86069547 CAAGCCGGCGTCGGAGGCGCGGG - Exonic
1046661218 8:116950016-116950038 GGCCCCGCACTCGGAGCCGCCGG - Intergenic
1048554128 8:135458054-135458076 CGCGGCGGAGACGGAGGCCCGGG + Intronic
1049373905 8:142280157-142280179 CCCCCAGGAGACGGAGGTGCTGG - Intronic
1049673046 8:143878171-143878193 CGCCCCTGAGTCCCGGGCGCCGG - Intronic
1049803069 8:144527118-144527140 GGCGCCGGAGTCGGGTGCGCGGG + Exonic
1049973547 9:841733-841755 CGCTCCGGAGGAGGAGGCGCAGG - Exonic
1053620499 9:39809645-39809667 CGCGATGGAGTCGGAGCCGCTGG + Intergenic
1053626203 9:39874289-39874311 CGCGATGGAGTCGGAGCCGCTGG - Intergenic
1053878671 9:42568944-42568966 CGCGATGGAGTCGGAGCCGCTGG + Intergenic
1053893998 9:42725434-42725456 CGCGATGGAGTCGGAGCCGCTGG - Intergenic
1054217685 9:62376412-62376434 CGCGATGGAGTCGGAGCCGCTGG + Intergenic
1054233017 9:62532751-62532773 CGCGATGGAGTCGGAGCCGCTGG - Intergenic
1054263660 9:62897798-62897820 CGCGATGGAGTCGGAGCCGCTGG - Intergenic
1060672591 9:125483038-125483060 CACTCAGGAGTCGGAGGCCCAGG - Intronic
1061208702 9:129178491-129178513 CGCGCGGGACTCGGAGCCGCCGG + Intergenic
1061399961 9:130362904-130362926 CCTCCCAGAGTCGGAGGCCCGGG - Intronic
1061517274 9:131097016-131097038 CTACCTGGAGTCGGAGGCGACGG - Intronic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1185747383 X:2583910-2583932 GGGCCCGGAGTAGGGGGCGCGGG + Intergenic
1187172922 X:16869756-16869778 CGCCCCGGGGCCGAGGGCGCCGG + Exonic
1190246922 X:48696879-48696901 GGCCCCGGCGTCCGAGGCCCCGG + Intronic
1190618386 X:52261937-52261959 CTCCCCGGACTCCGATGCGCAGG - Intergenic
1191053926 X:56222833-56222855 GGCCCCGCACTCGGAGCCGCCGG - Intergenic
1195126399 X:101813392-101813414 CTCCCTGGAGTGGGAGGCCCAGG - Intergenic
1195179183 X:102339944-102339966 CTCCCTGGAGTGGGAGGCCCAGG + Intergenic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1201017886 Y:9624035-9624057 AGCCCTGGAGTCGGAGGCCGAGG - Intergenic
1201489447 Y:14524780-14524802 CACCGCGGAGTGGAAGGCGCAGG - Intronic
1202109425 Y:21405507-21405529 AGCCCTGGAGTCGGAGGCCGAGG - Intergenic