ID: 1099204266 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:79710768-79710790 |
| Sequence | GGAGGCACCAAGAGTCAGCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1099204266_1099204273 | 11 | Left | 1099204266 | 12:79710768-79710790 | CCTCGCTGACTCTTGGTGCCTCC | No data | ||
| Right | 1099204273 | 12:79710802-79710824 | GCCCACTCTGGCCGCGCTTAAGG | No data | ||||
| 1099204266_1099204271 | -1 | Left | 1099204266 | 12:79710768-79710790 | CCTCGCTGACTCTTGGTGCCTCC | No data | ||
| Right | 1099204271 | 12:79710790-79710812 | CTTGGCCTCGGAGCCCACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1099204266 | Original CRISPR | GGAGGCACCAAGAGTCAGCG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||