ID: 1099204266

View in Genome Browser
Species Human (GRCh38)
Location 12:79710768-79710790
Sequence GGAGGCACCAAGAGTCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099204266_1099204273 11 Left 1099204266 12:79710768-79710790 CCTCGCTGACTCTTGGTGCCTCC No data
Right 1099204273 12:79710802-79710824 GCCCACTCTGGCCGCGCTTAAGG No data
1099204266_1099204271 -1 Left 1099204266 12:79710768-79710790 CCTCGCTGACTCTTGGTGCCTCC No data
Right 1099204271 12:79710790-79710812 CTTGGCCTCGGAGCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099204266 Original CRISPR GGAGGCACCAAGAGTCAGCG AGG (reversed) Intergenic
No off target data available for this crispr