ID: 1099205478

View in Genome Browser
Species Human (GRCh38)
Location 12:79721593-79721615
Sequence GATTATGTTTGTTGACCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099205478_1099205482 29 Left 1099205478 12:79721593-79721615 CCTTAAGGTCAACAAACATAATC No data
Right 1099205482 12:79721645-79721667 ATTGGTCCTGGCACACAAGTAGG No data
1099205478_1099205481 17 Left 1099205478 12:79721593-79721615 CCTTAAGGTCAACAAACATAATC No data
Right 1099205481 12:79721633-79721655 TCAACACACAGCATTGGTCCTGG No data
1099205478_1099205479 11 Left 1099205478 12:79721593-79721615 CCTTAAGGTCAACAAACATAATC No data
Right 1099205479 12:79721627-79721649 ACATCCTCAACACACAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099205478 Original CRISPR GATTATGTTTGTTGACCTTA AGG (reversed) Intergenic
No off target data available for this crispr