ID: 1099205479

View in Genome Browser
Species Human (GRCh38)
Location 12:79721627-79721649
Sequence ACATCCTCAACACACAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099205473_1099205479 30 Left 1099205473 12:79721574-79721596 CCCTTCTGCATTGTGAGCCCCTT No data
Right 1099205479 12:79721627-79721649 ACATCCTCAACACACAGCATTGG No data
1099205477_1099205479 12 Left 1099205477 12:79721592-79721614 CCCTTAAGGTCAACAAACATAAT No data
Right 1099205479 12:79721627-79721649 ACATCCTCAACACACAGCATTGG No data
1099205474_1099205479 29 Left 1099205474 12:79721575-79721597 CCTTCTGCATTGTGAGCCCCTTA No data
Right 1099205479 12:79721627-79721649 ACATCCTCAACACACAGCATTGG No data
1099205476_1099205479 13 Left 1099205476 12:79721591-79721613 CCCCTTAAGGTCAACAAACATAA No data
Right 1099205479 12:79721627-79721649 ACATCCTCAACACACAGCATTGG No data
1099205478_1099205479 11 Left 1099205478 12:79721593-79721615 CCTTAAGGTCAACAAACATAATC No data
Right 1099205479 12:79721627-79721649 ACATCCTCAACACACAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099205479 Original CRISPR ACATCCTCAACACACAGCAT TGG Intergenic
No off target data available for this crispr