ID: 1099205482

View in Genome Browser
Species Human (GRCh38)
Location 12:79721645-79721667
Sequence ATTGGTCCTGGCACACAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099205478_1099205482 29 Left 1099205478 12:79721593-79721615 CCTTAAGGTCAACAAACATAATC No data
Right 1099205482 12:79721645-79721667 ATTGGTCCTGGCACACAAGTAGG No data
1099205477_1099205482 30 Left 1099205477 12:79721592-79721614 CCCTTAAGGTCAACAAACATAAT No data
Right 1099205482 12:79721645-79721667 ATTGGTCCTGGCACACAAGTAGG No data
1099205480_1099205482 -9 Left 1099205480 12:79721631-79721653 CCTCAACACACAGCATTGGTCCT No data
Right 1099205482 12:79721645-79721667 ATTGGTCCTGGCACACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099205482 Original CRISPR ATTGGTCCTGGCACACAAGT AGG Intergenic
No off target data available for this crispr