ID: 1099205876

View in Genome Browser
Species Human (GRCh38)
Location 12:79725805-79725827
Sequence ATTTATAAGAATATGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099205876_1099205880 13 Left 1099205876 12:79725805-79725827 CCAACCAGCATATTCTTATAAAT No data
Right 1099205880 12:79725841-79725863 TGATGGTAATAAAAAATCAAGGG No data
1099205876_1099205878 -4 Left 1099205876 12:79725805-79725827 CCAACCAGCATATTCTTATAAAT No data
Right 1099205878 12:79725824-79725846 AAATGATATAATTTAAATGATGG No data
1099205876_1099205879 12 Left 1099205876 12:79725805-79725827 CCAACCAGCATATTCTTATAAAT No data
Right 1099205879 12:79725840-79725862 ATGATGGTAATAAAAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099205876 Original CRISPR ATTTATAAGAATATGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr