ID: 1099206049

View in Genome Browser
Species Human (GRCh38)
Location 12:79727618-79727640
Sequence GTGGTGTAGAGGAGGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099206042_1099206049 -9 Left 1099206042 12:79727604-79727626 CCCTCCCTACTGTGGTGGTGTAG No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data
1099206038_1099206049 13 Left 1099206038 12:79727582-79727604 CCAAGTAATAATGAGATGTCCTC No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data
1099206037_1099206049 16 Left 1099206037 12:79727579-79727601 CCACCAAGTAATAATGAGATGTC No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data
1099206035_1099206049 22 Left 1099206035 12:79727573-79727595 CCACTCCCACCAAGTAATAATGA No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data
1099206036_1099206049 17 Left 1099206036 12:79727578-79727600 CCCACCAAGTAATAATGAGATGT No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data
1099206043_1099206049 -10 Left 1099206043 12:79727605-79727627 CCTCCCTACTGTGGTGGTGTAGA No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data
1099206041_1099206049 -6 Left 1099206041 12:79727601-79727623 CCTCCCTCCCTACTGTGGTGGTG No data
Right 1099206049 12:79727618-79727640 GTGGTGTAGAGGAGGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099206049 Original CRISPR GTGGTGTAGAGGAGGCTAGG TGG Intergenic
No off target data available for this crispr