ID: 1099208542

View in Genome Browser
Species Human (GRCh38)
Location 12:79756916-79756938
Sequence CAGAGGCAGGAAACCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099208534_1099208542 30 Left 1099208534 12:79756863-79756885 CCTATATCTCTGGGTCTAGGAGT No data
Right 1099208542 12:79756916-79756938 CAGAGGCAGGAAACCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099208542 Original CRISPR CAGAGGCAGGAAACCTCTCT TGG Intergenic
No off target data available for this crispr