ID: 1099212416

View in Genome Browser
Species Human (GRCh38)
Location 12:79808248-79808270
Sequence CAGAGTAAGGGGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099212416 Original CRISPR CAGAGTAAGGGGAAAGTGGG AGG (reversed) Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900402807 1:2479509-2479531 CACAGGAAAGGGAAAGGGGGAGG + Intronic
900626459 1:3610901-3610923 CAAAAGAAGGGGAGAGTGGGAGG + Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901755204 1:11437299-11437321 CAGAGTAAGGTGGAAGAGGCAGG - Intergenic
901955874 1:12785148-12785170 CTCAGTAAGGGAAAAGTGGCAGG + Intergenic
901979247 1:13021196-13021218 CTCAGTAAGGGAAAAGTGGCAGG + Intronic
902002835 1:13207742-13207764 CTCAGTAAGGGAAAAGTGGCAGG - Intergenic
902022063 1:13353506-13353528 CTCAGTAAGGGAAAAGTGGCAGG - Intergenic
902606356 1:17571463-17571485 CAGAGAAATGGGGTAGTGGGTGG + Intronic
903134297 1:21299237-21299259 CAGAGGGAGGAGGAAGTGGGTGG + Intronic
903146386 1:21375389-21375411 CAGAGAAACGGAAAAGTGTGAGG + Intergenic
903407138 1:23107236-23107258 CAGCGTAAGGTGATAGTGGTGGG - Intronic
904310800 1:29628326-29628348 GAGAGGGTGGGGAAAGTGGGAGG + Intergenic
904376600 1:30085922-30085944 CAGAGAGAGGGGAGAGTGGGTGG - Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904989262 1:34578389-34578411 CAGAGTAAAGGGACAAAGGGTGG - Intergenic
905130034 1:35747348-35747370 CAGAGAAATGGCAAAGTAGGGGG + Intronic
905330847 1:37195648-37195670 AAGAGAGAGGGGAAAGTGGGAGG - Intergenic
905795326 1:40812914-40812936 CAGAATAAGGGGCAAGAGAGTGG + Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906028682 1:42699023-42699045 AGTAGTAAGGGGAAAATGGGGGG + Intronic
906033208 1:42736100-42736122 CAGAGGAAGGGCAGAGTGTGTGG + Intronic
906049369 1:42857795-42857817 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
906509395 1:46402261-46402283 CAGAGGGAGGGGAAAGGGAGGGG - Intronic
906542156 1:46595413-46595435 CAGAGGAAGGAGGCAGTGGGTGG - Intronic
906938272 1:50233787-50233809 CAGGGGAAGGGAAAAGTTGGAGG - Intergenic
906948325 1:50314692-50314714 CAGTGTTGGTGGAAAGTGGGGGG - Intergenic
907575032 1:55518711-55518733 CAGAGAAAGGGGGTAGTGGCTGG + Intergenic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
907859533 1:58338314-58338336 AAGAGTGAGGTGGAAGTGGGAGG - Intronic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
909531397 1:76685549-76685571 GAGAGTAACAGGAAAGTAGGAGG - Intergenic
909818493 1:80027694-80027716 CAGAGGAGGGGGGCAGTGGGAGG + Intergenic
910488801 1:87745694-87745716 CAGAGTACGAGGATAATGGGAGG + Intergenic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
911452056 1:98075608-98075630 CAGAGGAAAGGAAAAGTGAGGGG - Intergenic
911871711 1:103107987-103108009 GGGAGGAAGGGTAAAGTGGGGGG + Intronic
912262361 1:108122322-108122344 CCGAGTTAGGGGAAAGGAGGAGG - Intergenic
912361706 1:109100775-109100797 AGGAGAAATGGGAAAGTGGGAGG - Intergenic
912561331 1:110553770-110553792 CAGAGTGAGGGGATAGTTTGAGG - Intergenic
913078004 1:115357669-115357691 AAGTGGATGGGGAAAGTGGGAGG + Intergenic
913162560 1:116157408-116157430 CAGAGTCAGGGGAGAGTCAGTGG + Intergenic
914496371 1:148201360-148201382 CAGAGCGAGAGCAAAGTGGGAGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915087578 1:153398586-153398608 CAGAGGAAGTGGGGAGTGGGAGG - Intergenic
916804510 1:168245100-168245122 GGGAGTAGGGGGAAAGAGGGAGG + Exonic
919598202 1:199590642-199590664 GGGAGTAAGGGGAGAGTGGTAGG + Intergenic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
922046246 1:221948838-221948860 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
922327951 1:224546495-224546517 CAGCGTCAGGGGAAATTAGGAGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922751069 1:228070260-228070282 CAGTGTAAAGGGATAGTGTGGGG + Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
924542432 1:244993977-244993999 CATAGTAAGGAGGAAATGGGAGG + Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064256974 10:13750653-13750675 CAGAGTAAGAGGAATGTCAGGGG + Intronic
1064539386 10:16390067-16390089 CATAGTAAGGGGCAAGTGTCTGG + Intergenic
1064628526 10:17285728-17285750 CAGAGAGAAGGGAAAGGGGGAGG + Intergenic
1066214663 10:33274471-33274493 CCAAGTAAGGGGAAAGTGATGGG + Intronic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1069962273 10:72086257-72086279 GAGAGGAAGGGGGAAGTGGTTGG + Intronic
1070289767 10:75106573-75106595 CAGAGGATCGGGAAGGTGGGGGG - Intronic
1070543839 10:77437292-77437314 AAAAGGAAGGGGAGAGTGGGAGG + Intronic
1070833931 10:79436336-79436358 CTGAGTAAGGGGAAAGGATGAGG - Intronic
1071725690 10:88196208-88196230 AAAAAGAAGGGGAAAGTGGGAGG + Intergenic
1073140805 10:101246320-101246342 CAGAGTAATAGGCCAGTGGGTGG + Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1076050565 10:127329822-127329844 GAGAGTAGAGGGAGAGTGGGTGG + Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1077177732 11:1198211-1198233 GAGGGTGAGGGGAGAGTGGGCGG + Intronic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1078091989 11:8269572-8269594 CAGTGAGAGGGCAAAGTGGGTGG - Intergenic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1079365012 11:19801463-19801485 AAGAGGAAAAGGAAAGTGGGAGG - Intronic
1079818133 11:25089043-25089065 CAAAGTAACGGGAGAGTGGTGGG - Intergenic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1081270151 11:41073311-41073333 AAGAGGAGGGGGAAAGTGAGGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081964173 11:47159550-47159572 AAGAGTAAGGGGGAGGCGGGTGG + Intronic
1082780527 11:57284118-57284140 CAGTGCAAAGGGAAAGTGCGGGG + Intergenic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083703918 11:64500107-64500129 CAGAGCAATGGAAGAGTGGGTGG + Intergenic
1084157568 11:67322723-67322745 CACAGAAATGGGAAATTGGGAGG + Intronic
1084644332 11:70445885-70445907 CAGAGGGAGGGGAAAGCTGGTGG + Intergenic
1085771739 11:79331596-79331618 CAGTGTAAGGAGACTGTGGGAGG + Intronic
1085933872 11:81120844-81120866 CAGACTTAGGGTCAAGTGGGAGG - Intergenic
1086200440 11:84195133-84195155 AAGAGTAGAGGGAAAGTGAGAGG - Intronic
1087085473 11:94213814-94213836 CAGAGGCATGGGAAAATGGGAGG - Intergenic
1087420590 11:97920578-97920600 AAGAGTAAGTGGAAACTGGCAGG - Intergenic
1087694606 11:101362237-101362259 TAGAGGAAGGGTAAAGAGGGAGG + Intergenic
1088646269 11:111919100-111919122 CAGAGGAAGGTGGCAGTGGGAGG - Intronic
1088771055 11:113036493-113036515 CACAGAAAGGGCAGAGTGGGAGG - Intronic
1089273763 11:117319235-117319257 AAGGGTAAGGGGAAAGAGTGAGG + Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090521209 11:127481376-127481398 CAGAGAAAGGGAAAAATGGAAGG - Intergenic
1090703197 11:129314724-129314746 AAGAGGAAGGGGAAAGAGAGGGG - Intergenic
1090961501 11:131561482-131561504 CAGAGTGAAAGGATAGTGGGTGG + Intronic
1091543138 12:1480917-1480939 CAGAGTAAGGGGGACGTCTGGGG - Intronic
1092930412 12:13310273-13310295 CAGAGGAAGGGAAATATGGGAGG - Intergenic
1093024179 12:14231839-14231861 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1093281695 12:17203738-17203760 CAGAGCAAGGGGGATGGGGGGGG - Intergenic
1095578548 12:43767571-43767593 CAAAGTATGTGAAAAGTGGGTGG + Intronic
1096101720 12:48973817-48973839 GACAGGAGGGGGAAAGTGGGGGG + Intergenic
1096106776 12:49000612-49000634 CAGAGAGAGGGGAGAGTGTGTGG + Intergenic
1096749450 12:53749403-53749425 CAGACTAAGGGGAAATGGGGAGG + Intergenic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1096894076 12:54802512-54802534 CAGAGTTGGGGGAAACTTGGTGG - Intergenic
1097622472 12:61957403-61957425 CAGAGTGAGGGGTCAGTGGATGG + Intronic
1097691551 12:62738961-62738983 CATAGAAACGGGAAAGTGGGGGG + Intronic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099698896 12:86059771-86059793 CAGAGAAAGGGGCAAGTGAAAGG - Intronic
1100490341 12:95072840-95072862 GAGAGAAAAGTGAAAGTGGGGGG + Intronic
1100762622 12:97826088-97826110 CAAAGTAAAGGGAAAATGGCAGG + Intergenic
1100897553 12:99201108-99201130 CAGAGTAAGGGAAGAGAGAGTGG + Intronic
1102208710 12:111108684-111108706 AAGAGAAGGGGGAAAATGGGTGG - Intronic
1102394265 12:112574254-112574276 AAGAGGAAGAGGAGAGTGGGAGG + Intronic
1103724201 12:122989756-122989778 CCCAGTGAGGGGAAAGTGTGTGG + Intronic
1104969597 12:132525239-132525261 CACAGCCAGGGGACAGTGGGTGG + Intronic
1105318446 13:19291030-19291052 CAGAGAAATGGGTACGTGGGAGG + Intergenic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1112001110 13:95210907-95210929 CAGAGAGAGGGGGCAGTGGGGGG - Intronic
1112063958 13:95771460-95771482 CAGAGTTGGGGGTCAGTGGGTGG + Intronic
1112261798 13:97884256-97884278 CAGACTCAGGGGAAAGTGGCTGG + Intergenic
1112295702 13:98185019-98185041 CAGAGTTAGGAAAAAGTGTGTGG + Intronic
1112418391 13:99225310-99225332 CAGAGGCAGGGTACAGTGGGCGG - Intronic
1112559231 13:100497128-100497150 CAGAGAAATGGGGAATTGGGGGG + Intronic
1112710621 13:102123621-102123643 CAAAGTAATGGGAAAATGGTAGG - Intronic
1113483798 13:110640384-110640406 GAGAGCAACGGGAAAGTGTGGGG + Intergenic
1114245116 14:20905581-20905603 AAGAGTAAGGGAAGAGTGGAAGG + Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114658021 14:24327706-24327728 CAGAGACAGGAGGAAGTGGGGGG + Intronic
1115120317 14:29929088-29929110 CAGAGGAAGGGGAAAGTCTAGGG - Intronic
1115786935 14:36837105-36837127 CAGAGTGATGGGAAGGTGTGTGG + Intronic
1117533946 14:56686614-56686636 CAGAGTCAGGGGAAAGGGCACGG - Intronic
1117990159 14:61425131-61425153 CAGTGCAAAGGGAAAGTGAGGGG + Intronic
1118171962 14:63396258-63396280 AAGAGGAGGGGGAAAGTAGGGGG + Intronic
1119040128 14:71267104-71267126 CAGAGTATGGGGAAACTTGATGG - Intergenic
1119054820 14:71408614-71408636 CAAGGAAAGGGGAAAGGGGGTGG - Intronic
1119159885 14:72444008-72444030 CAGGGCAAGGGGAGAGTGTGCGG - Intronic
1119523335 14:75302422-75302444 CAGAGTAAAGGGAAAGGGAGTGG - Intergenic
1119651190 14:76384672-76384694 AGGAGCAAGGGGAAACTGGGAGG - Intronic
1119759002 14:77138591-77138613 CAGAGCAGAGGGAACGTGGGTGG - Intronic
1120462600 14:84816048-84816070 CACAAAAAGGGGAATGTGGGTGG - Intergenic
1120694690 14:87631556-87631578 CAGAGGAAAGGTACAGTGGGAGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121004677 14:90482454-90482476 ATGAGAAAGAGGAAAGTGGGAGG - Intergenic
1121506146 14:94479077-94479099 CATGGGAAGGAGAAAGTGGGAGG + Intronic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1122342888 14:101039836-101039858 CAGGGTAAGTGGAAAGTCGGTGG + Intergenic
1122342947 14:101040217-101040239 CAGGGTAAGTGGAAAGATGGTGG + Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123905486 15:24916320-24916342 AAAACTTAGGGGAAAGTGGGGGG + Intronic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126062719 15:44799435-44799457 CAGAGTAACAGGTGAGTGGGTGG - Intergenic
1126951310 15:53884809-53884831 AGGAGTAAAGGGAAAGAGGGGGG - Intergenic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127341752 15:58052821-58052843 CAGAGGAAGGGGTAAATGCGTGG + Intronic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1131222745 15:90598635-90598657 CAGATTAAGGGGACAGTGATTGG + Intronic
1131251949 15:90836796-90836818 CAGAGTGAGGGCACAGTGGACGG - Intergenic
1131755070 15:95550711-95550733 GAGAGTAAGGGGAAAGGAGAGGG - Intergenic
1132012900 15:98291708-98291730 AAGAGGAAGAGAAAAGTGGGTGG + Intergenic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1132716511 16:1292700-1292722 GAGAGGGAGGGGGAAGTGGGGGG - Intergenic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1133313991 16:4870777-4870799 CAGAGTGAGGGGAGAGGCGGTGG + Intronic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133692790 16:8232738-8232760 CAGAGGCAGAGGAAGGTGGGTGG - Intergenic
1133706574 16:8360326-8360348 CAGAGGAAGGTGAACCTGGGAGG - Intergenic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1134247853 16:12553277-12553299 CAGAGTAAGAGGAAAATGAGTGG + Intronic
1134513492 16:14867938-14867960 GCGAGTGAGGGGACAGTGGGAGG - Intronic
1134609954 16:15600045-15600067 CAGAGTGAGGGCTCAGTGGGTGG - Intronic
1134701129 16:16266433-16266455 GCGAGTGAGGGGACAGTGGGAGG - Intronic
1134970699 16:18528213-18528235 GCGAGTGAGGGGACAGTGGGAGG + Intronic
1135020378 16:18957937-18957959 CAGACTAGGAGGAAAGTTGGAGG - Intergenic
1135392568 16:22106052-22106074 CTGAGTAAGGGAACAGAGGGTGG + Intronic
1135526114 16:23214935-23214957 CAGAGTAAGAGGAAACAGGAAGG + Intronic
1135817634 16:25650252-25650274 GAGAGTAAGGGGAAAATGTGTGG - Intergenic
1136631824 16:31493409-31493431 CGGAGTGAGGGGAGTGTGGGTGG + Intronic
1137369813 16:47894861-47894883 TAGAGTTAAGGCAAAGTGGGTGG + Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140899726 16:79356672-79356694 GAGAGCCAGTGGAAAGTGGGGGG - Intergenic
1141150497 16:81561534-81561556 TAGAGTGAGGGGGAAGAGGGTGG + Intronic
1142857079 17:2737084-2737106 CAGAGTCATGGGGAAGGGGGCGG - Intergenic
1143621272 17:8081374-8081396 TAGAGCAAGAGGAAAGAGGGTGG - Exonic
1144027591 17:11292277-11292299 CAGAGTAGGGGGAAAGGGGAGGG - Intronic
1144178551 17:12731316-12731338 CAGAGTAGGAGGAGTGTGGGTGG - Intronic
1144378433 17:14668705-14668727 GAGATTAAGGAGAAAGTGGGTGG - Intergenic
1144626781 17:16847989-16848011 CAGACTCAGGGGCAGGTGGGGGG - Intergenic
1145152583 17:20519664-20519686 CAGACTCAGGGGCAGGTGGGGGG - Intergenic
1145193796 17:20869281-20869303 CAGAGGGAGGGGAAAAAGGGTGG + Intronic
1145848461 17:28066147-28066169 CAGGGTAAGAGGAAAGGGAGAGG - Intronic
1146124902 17:30223849-30223871 CGAAGGAAGGGGGAAGTGGGGGG - Intronic
1146147010 17:30427911-30427933 CAGAGTAGGGGGACAGGCGGGGG - Intronic
1146455220 17:33004425-33004447 AAGAGAAAGGGGAAGGTGTGAGG + Intergenic
1146822411 17:35994241-35994263 CAGAGTAAGGGGATAGGGATGGG - Intronic
1147262031 17:39214378-39214400 CAGAGCGAGTGGAGAGTGGGGGG - Intronic
1147312115 17:39601554-39601576 CAGAGTGCAGGGAATGTGGGGGG + Intergenic
1147782361 17:42952758-42952780 CAGAGGAAGAGGAAAATGGACGG + Intronic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149585793 17:57785488-57785510 CACAGTAAGGGGAAAGGTTGGGG - Intergenic
1149617040 17:58009178-58009200 CAGAGGAATGGGAAAATGAGGGG + Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151797060 17:76353515-76353537 CAGAGTAAGGGGGCGGTGGGAGG - Exonic
1152230154 17:79110328-79110350 CAGAGGATGTGGAGAGTGGGAGG - Intronic
1152261321 17:79268802-79268824 GAGAGAAAGAGGAAAGAGGGTGG - Intronic
1152390896 17:80003108-80003130 AAGGGCAAGAGGAAAGTGGGAGG + Intronic
1152664097 17:81557413-81557435 CAGAGTAAGGGAAATGCTGGTGG + Exonic
1153874089 18:9350446-9350468 CTGAGTAATGGGTAAATGGGGGG - Intronic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1155254561 18:23983330-23983352 GAAAGAAAGGGGAAATTGGGAGG + Intergenic
1155930034 18:31697389-31697411 TAGAGGAAGGGGGAAGAGGGAGG + Intergenic
1156434024 18:37106907-37106929 TAGTGTAAGGGGTAAGTGGCAGG - Intronic
1156487012 18:37472765-37472787 CAGAGAAGGGAGAAATTGGGAGG + Intronic
1156566918 18:38202148-38202170 AAGAGCAAAGGGAAAGTGGTGGG - Intergenic
1156618930 18:38825582-38825604 CAGAAAAGTGGGAAAGTGGGAGG - Intergenic
1156741498 18:40335724-40335746 AAGAGCAAGAGAAAAGTGGGAGG - Intergenic
1159071245 18:63625994-63626016 AAGAGAGAGAGGAAAGTGGGAGG + Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1160209761 18:76867063-76867085 AAGAGTAAGTGAAAAGAGGGTGG + Intronic
1160290977 18:77593325-77593347 CAGAGAAAATGGAAAGTTGGAGG - Intergenic
1160465051 18:79069365-79069387 CGAATTGAGGGGAAAGTGGGAGG + Intronic
1161568308 19:5015837-5015859 CAGAGCACGGGGAGAGAGGGGGG - Intronic
1161960673 19:7521224-7521246 AAGAGCAAGGGGTAAGTGAGAGG - Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1163209443 19:15829720-15829742 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1166415379 19:42591523-42591545 CAGAGTTAGGCAAAATTGGGAGG + Intronic
1167175313 19:47860617-47860639 AAGAGGGAGGGGAAAGTAGGGGG - Intergenic
1167244240 19:48364270-48364292 CTGAGTAGGCGGAAAGAGGGAGG + Intergenic
1167900913 19:52621661-52621683 CAGGCTAAGGGGGAAGTAGGAGG - Intronic
1168474906 19:56668702-56668724 CAGAGGAAAGGTAAAGGGGGTGG + Intronic
1168592897 19:57651782-57651804 GAGAGAAAAGGGAAAGTGGTAGG - Intergenic
925869249 2:8254914-8254936 CAGAGCCAGGAGAAAGTGAGGGG - Intergenic
926312563 2:11685259-11685281 GAGAGGACGGGAAAAGTGGGAGG + Intronic
926476996 2:13336162-13336184 GAGAGTGCGGGGAAAGTGGTGGG + Intergenic
926994377 2:18718004-18718026 AACAGAAAGGGGAAAATGGGAGG + Intergenic
927048516 2:19303990-19304012 CGGAGTGAGGGGACAGTGAGGGG - Intergenic
927269127 2:21186969-21186991 CAGAGTGCTGGGAAAATGGGTGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927735188 2:25514356-25514378 TAGAGCAATGGGAAAGTGGCAGG + Intronic
927869150 2:26612812-26612834 CAGAGTATGGGACAAGGGGGAGG + Intronic
928102965 2:28450111-28450133 CAGAGGAGGGGGAAAGAAGGAGG - Intergenic
928173736 2:29020530-29020552 CAGAGGTAGGGCAAAGGGGGAGG + Intronic
928255852 2:29721828-29721850 CAGAGTAAAGGGACAATGGCTGG - Intronic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929722951 2:44389355-44389377 AAGAATTTGGGGAAAGTGGGAGG + Intronic
930094417 2:47556115-47556137 CAGAGAAATGGGAAAGTAGCAGG + Intronic
930965570 2:57320002-57320024 CACAGTCAGGGGATAGTGGGAGG + Intergenic
931634865 2:64332071-64332093 CAGAGTAAAGGGCAGGTGTGTGG + Intergenic
932033551 2:68215800-68215822 AAGATGGAGGGGAAAGTGGGTGG + Intronic
932383981 2:71313654-71313676 GAGAGAAAGGGGGAAGAGGGAGG - Intronic
932622992 2:73277109-73277131 CAGGGGAAGGGGAAAGTCTGGGG + Intronic
932726492 2:74184093-74184115 CAGACAAGGGGGAAAGTGAGGGG + Intergenic
933431833 2:82191516-82191538 CAGATTATCAGGAAAGTGGGAGG + Intergenic
934949163 2:98564545-98564567 CAGAGGAAGGGGGCGGTGGGGGG + Intronic
935462096 2:103349083-103349105 CAGATGAAGGGAAAAGTGGTTGG + Intergenic
936070734 2:109369582-109369604 GAGAGGATGGGGAAAGTGAGGGG + Intronic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937245403 2:120489176-120489198 CAGAGCAAGACAAAAGTGGGAGG + Intergenic
937264188 2:120605823-120605845 CAGAGTGAGGTGGAAGGGGGTGG + Intergenic
937421014 2:121755521-121755543 CAGAGGAGAGGGAGAGTGGGCGG - Exonic
937515506 2:122650645-122650667 GAGAGTGAGGGCAAGGTGGGTGG + Intergenic
938366204 2:130736583-130736605 CAGGGGAGAGGGAAAGTGGGAGG - Intergenic
938448050 2:131392172-131392194 CAGAGTCAGAGGAACGTGTGTGG - Intergenic
939290890 2:140193628-140193650 TAGAGAATGGGGAAAGTAGGGGG - Intergenic
939389187 2:141544614-141544636 CACAGGAAGGTGAAAGTGTGTGG - Intronic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940661127 2:156546500-156546522 CAGGGTAAGGGGTAAGGGGTAGG + Intronic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941597605 2:167497220-167497242 CAGAGGAAGGGAAATGAGGGGGG + Intergenic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
944412609 2:199458367-199458389 AAGAGGAAGGGGAGAGTCGGCGG + Intronic
945096833 2:206228497-206228519 GAGAGTTAGAGGAAAGGGGGTGG + Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945361507 2:208900503-208900525 CAGACTAAGGGAGAAGAGGGAGG - Intergenic
945641332 2:212434508-212434530 AAGAGTAGGGGGAGTGTGGGGGG + Intronic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946118103 2:217481733-217481755 CATATTAATGGGAAAGAGGGAGG - Intronic
946217075 2:218192638-218192660 GAGAATAAAGGGAAAGGGGGAGG + Intergenic
946941591 2:224775125-224775147 CAGATTATGGGCAAAGTGAGTGG + Intronic
947033246 2:225822105-225822127 CAGAGGACCTGGAAAGTGGGAGG - Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948498407 2:238370805-238370827 AAGAGAAAGGGGGAAGTGGAAGG + Intronic
948658043 2:239488987-239489009 CAGATGAATGGGAGAGTGGGTGG - Intergenic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
1168994080 20:2119653-2119675 CATATTAAGGGAAAAGGGGGTGG - Intronic
1170021024 20:11836975-11836997 AAGAGTGAGGGGGCAGTGGGTGG - Intergenic
1170451889 20:16491395-16491417 CAGACTAAGGGGCAAGAGAGTGG + Intronic
1171203075 20:23257272-23257294 CAGGGTCTGGGGGAAGTGGGAGG - Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172617479 20:36298760-36298782 CAGAGTGTGGGGCAAGTGGGAGG - Intergenic
1172638819 20:36428603-36428625 CAAAGAAAGGGGACAGTGTGGGG - Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1173073271 20:39790885-39790907 CACTGTAAGGGCAAGGTGGGAGG + Intergenic
1173182211 20:40814036-40814058 AAGAGAAAGAGGAAAGCGGGAGG - Intergenic
1173453854 20:43188875-43188897 CAGAGTAGGGGGAGCGGGGGCGG - Intronic
1173474906 20:43352088-43352110 AAGAGAAAGGGGGAGGTGGGAGG + Intergenic
1173702835 20:45088213-45088235 CAAAGCAAGGGTAAAGTGTGAGG - Intergenic
1173759931 20:45550428-45550450 CAGAGAAAGGGGGAAGAGAGAGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174513749 20:51075476-51075498 AAGAGTAGGGGGAAAGATGGGGG - Intergenic
1177159899 21:17536502-17536524 CAGAGTAGAGGGAAAGTGAAAGG - Intronic
1177816235 21:25980205-25980227 CAGAGTCAGGGTACAGTGGTAGG + Intronic
1178043011 21:28662370-28662392 CAGCGGAGGGGGAAAGAGGGAGG - Intergenic
1179594571 21:42433819-42433841 CAGAGTCAGGGGGCAGTGGGGGG - Intronic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1181163012 22:20968659-20968681 GAGAGAAGAGGGAAAGTGGGGGG - Intronic
1182277521 22:29200112-29200134 CAGGGTCTGGGGACAGTGGGAGG + Intergenic
1182772190 22:32803630-32803652 AAGGGTAAGTGGAATGTGGGTGG - Intronic
1183739716 22:39662906-39662928 TAGAGTAGGGGTAACGTGGGAGG + Intronic
1183774285 22:39953148-39953170 CAGAGTCATCAGAAAGTGGGTGG - Intronic
1183972659 22:41489606-41489628 CAGAGTAAGGGAAATGCAGGAGG - Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184033823 22:41909436-41909458 CAGAGCCAGGGGGAAGTGGCTGG - Intergenic
1184106283 22:42369178-42369200 CAGAGAAAGGGAGAAGGGGGTGG - Intergenic
1184243212 22:43222419-43222441 CAGGGTCAGGGGACCGTGGGAGG - Intronic
1184903761 22:47464849-47464871 CAGAGTAAAGGAAAAGTAGGAGG - Intronic
1185241448 22:49749635-49749657 CAGTGCCAGGGGAAAGTAGGGGG + Intergenic
949092444 3:44613-44635 CAGAGTAAGTGAAAAGTAAGGGG - Intergenic
949980656 3:9500184-9500206 CAGAGTTAGGAGAGAGTGAGGGG - Exonic
950779775 3:15381388-15381410 GAGAGGAAGGGGGAAGAGGGAGG + Exonic
951296147 3:20937346-20937368 CAGAGTATTTGGGAAGTGGGTGG + Intergenic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
952804569 3:37335952-37335974 GGGGGTAATGGGAAAGTGGGTGG + Intronic
953158253 3:40394649-40394671 CAGGGTCAGGGAGAAGTGGGAGG - Intronic
953510807 3:43537018-43537040 CAGAGTAAGGTGAAAGGTGAGGG - Intronic
953654609 3:44839691-44839713 CAGAGTCTGGGGGAAGTGAGGGG - Intronic
954217753 3:49133795-49133817 GAGAGAAGGAGGAAAGTGGGTGG + Intergenic
955649097 3:61174043-61174065 CATATTAAGGGGAGTGTGGGAGG + Intronic
956122972 3:65984636-65984658 GAGAGTAAGGCTGAAGTGGGAGG - Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
956901090 3:73716895-73716917 CAGAGAAATGGGACAGTGGTAGG - Intergenic
957032706 3:75260689-75260711 CAGAGTAAGTGAAAAGTAAGGGG - Intergenic
957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957924965 3:86797118-86797140 CAGTGTAAGGAGTAAGTGAGAGG - Intergenic
958761641 3:98316333-98316355 CTCAGCAAGGGGAAAGTGGCAGG + Intergenic
959409839 3:106007355-106007377 CAGAGTAAGCTGAAAATGGAGGG + Intergenic
959711714 3:109392375-109392397 CAGAGTGAGGACAAAGTGTGGGG + Intergenic
959730525 3:109596236-109596258 CAGAGAAAGGTGAGAGTGAGGGG + Intergenic
959835944 3:110918020-110918042 CAAAAAAAAGGGAAAGTGGGAGG + Intergenic
960248759 3:115428777-115428799 GAGAGGAAGGGGGAAGAGGGAGG - Intergenic
960882570 3:122360513-122360535 CAGAGGGAAGGGAAAGTAGGAGG + Intronic
961021300 3:123509475-123509497 CACAGGAAGGGGAAGGTTGGAGG - Intronic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
962329386 3:134464178-134464200 CAGAGGAATGGGAAAGTTCGGGG - Intergenic
962343707 3:134605124-134605146 CAGAGCAAGGGGAGAGATGGGGG - Intronic
963106789 3:141654177-141654199 GAGGGGAAGAGGAAAGTGGGGGG + Intergenic
965297209 3:166963688-166963710 CAGAGACTGGGGAAAGTAGGAGG - Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966635396 3:182127782-182127804 CACAGTAAGAGAAAAGTGGTAGG + Intergenic
966669355 3:182509368-182509390 CAGGGAAGGGGGCAAGTGGGAGG + Intergenic
967483827 3:190006856-190006878 CAGAGTAATGGGAAACAAGGTGG + Intronic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
968382936 4:110601-110623 CAGAGCAAAGGGCAAGGGGGAGG + Intergenic
968985857 4:3873916-3873938 CAGGGAAAGGGGAGAGAGGGAGG + Intergenic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
969548664 4:7849226-7849248 CAGAGGGAGGGGAGAGTGAGAGG + Intronic
969616049 4:8253132-8253154 CAGGGAAAGGGGAAAGAAGGAGG - Intergenic
970124878 4:12797871-12797893 GAGTGGAAGGGGAAAGTGTGGGG - Intergenic
972946295 4:44260484-44260506 CAGAGTAAGGGAACAGAGTGGGG + Intronic
973146230 4:46830843-46830865 CAAAGTATGGAGAAAGTGAGAGG + Intronic
973330463 4:48906530-48906552 CCGAGTTAGGGGAGAGTGGGGGG + Intronic
973968330 4:56186133-56186155 CAGAGAAATGGGAAACTGGATGG + Intronic
974102074 4:57428449-57428471 CAGAGTCAGGGGAAAATGTAAGG - Intergenic
974949044 4:68565468-68565490 CAGAGTGAGGGGAATATGGGAGG - Intronic
974958076 4:68667936-68667958 CAGAGTGAGGGGAATATGGGAGG - Intronic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975835638 4:78419827-78419849 CAGAGCAGGAGGAAAGCGGGTGG + Intronic
975979633 4:80142879-80142901 AAGAGTAGGGGGATAGTGGTTGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976470337 4:85421016-85421038 CAAAGTAAGCTGACAGTGGGCGG + Intergenic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977007882 4:91594918-91594940 CAGAGAAAGGGAAAAGTAGGAGG - Intronic
977249483 4:94674118-94674140 GAGTGTCAGGGGAAAGTGTGGGG - Intergenic
977742720 4:100505722-100505744 CAGAGTAAGGGAGGAGTGAGAGG - Intronic
978514030 4:109552463-109552485 CAGAGTAAGGGCTAACTGGCAGG + Intergenic
980435571 4:132767638-132767660 AAGAGAGAGAGGAAAGTGGGAGG + Intergenic
980947304 4:139334743-139334765 TAGAGCAAGGGGAGAGTGTGTGG + Intronic
981661461 4:147171943-147171965 CAGAGAAAGGGGACAGTGGAAGG - Intergenic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
981838124 4:149079208-149079230 CAGAGTCAGGGCAAAGTTGCTGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982925192 4:161328286-161328308 GAGAGAAAGAGCAAAGTGGGAGG - Intergenic
983572343 4:169223757-169223779 CAGGGTAAGAGCACAGTGGGTGG + Intronic
984647830 4:182238455-182238477 CAGAGTAAGGGCATAGAGGCTGG - Intronic
985577286 5:679300-679322 CAGGGAAAGGGGTGAGTGGGTGG - Intronic
985592201 5:771351-771373 CAGGGAAAGGGGTGAGTGGGTGG - Intergenic
986369124 5:7062739-7062761 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
986764966 5:10917158-10917180 CAGAGTCAGGGAAATATGGGAGG + Intergenic
987485481 5:18520714-18520736 CAGAATAACAGGAATGTGGGGGG - Intergenic
988220211 5:28335363-28335385 CAGAAGGATGGGAAAGTGGGAGG + Intergenic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
988967314 5:36432331-36432353 CAGAGGATTGGGATAGTGGGAGG + Intergenic
989153134 5:38319620-38319642 AGGAGTATGGGGAATGTGGGAGG + Intronic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
992426338 5:76661897-76661919 CAGAGCAAGGGGAAAGGTGGTGG + Intronic
992753793 5:79885700-79885722 CAGACATGGGGGAAAGTGGGAGG + Intergenic
994178756 5:96740917-96740939 CAGAGAAAGGGGTTGGTGGGAGG + Intronic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995766991 5:115629315-115629337 CACAGGGTGGGGAAAGTGGGGGG + Intronic
996578754 5:125006461-125006483 AACAGTAAGGGGTATGTGGGGGG - Intergenic
997157089 5:131572745-131572767 CAGGCTAAGGGGGAAGAGGGAGG - Intronic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997285074 5:132672257-132672279 CAGAGTATGGGGGCAGGGGGTGG + Intergenic
997350357 5:133226541-133226563 CAGAGCTAGGGGTAAGAGGGAGG - Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997857726 5:137388381-137388403 CAGGGTAAGGGGTATGTGGCGGG + Intronic
998102274 5:139444345-139444367 CAGAGTCAGAGGAAAATGTGTGG + Intronic
1001120491 5:168976006-168976028 CAGGGTAAGGGTGAAGTTGGTGG - Intronic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1002138948 5:177126915-177126937 AGGAGTATGGGGAAAGGGGGAGG - Intergenic
1002922866 6:1585575-1585597 CAGAATGTGGGGAGAGTGGGGGG - Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1004787890 6:18989370-18989392 CAGAGCAAGGGGAGAGGAGGAGG - Intergenic
1004929624 6:20449767-20449789 CAGAGAAGGTGGAGAGTGGGAGG - Intronic
1006106562 6:31720363-31720385 CAGGGAAAATGGAAAGTGGGCGG + Intronic
1006592145 6:35166187-35166209 CAGAGAATGGGGGAAGAGGGAGG + Intergenic
1007197039 6:40071276-40071298 CTGAGTAAAAGGAAACTGGGGGG - Intergenic
1007432528 6:41785088-41785110 TAGAGGAAGGGGAATTTGGGGGG - Intronic
1007905812 6:45459775-45459797 CAGGGTAAGGGGACAGAGGGAGG + Intronic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1012181560 6:96160255-96160277 AAGAGTCAGGGGAAAGAGTGGGG + Intronic
1013044301 6:106469089-106469111 CAGAGTGAGGGGTGAGTGGTGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1013691323 6:112648318-112648340 CCGAGTAAGGGGACAGAGAGGGG + Intergenic
1013710265 6:112888810-112888832 TGGATTAAGGGGAAAGTGGGTGG - Intergenic
1015187175 6:130431154-130431176 CAGGGCAAGGGGAAAGCTGGAGG - Intronic
1015480280 6:133700901-133700923 CAGAGTAAGTGGAATGTGTTAGG - Intergenic
1015955684 6:138595813-138595835 AAGAGAAAGTGGAAAGTGAGGGG + Intronic
1015999749 6:139029972-139029994 CAAAGGAAGCGGAAAGTCGGAGG - Intronic
1016266872 6:142242940-142242962 CATTGTAAGGGGACACTGGGTGG - Intergenic
1016374037 6:143402318-143402340 CAGGACAACGGGAAAGTGGGGGG + Intergenic
1016389220 6:143558393-143558415 CATAGTAACGGGAAAGAGGTAGG - Intronic
1018221803 6:161588571-161588593 AAAAGTAAGGGCAAACTGGGAGG + Intronic
1018328674 6:162704103-162704125 AAGAGTGAGGGTAAAGTGTGAGG + Intronic
1018431915 6:163729515-163729537 CAGAGGAAGGTGAGAGTAGGTGG + Intergenic
1019133756 6:169895851-169895873 CAGCGAGAGGGGAAAGTGTGTGG - Intergenic
1019370136 7:658517-658539 CAGGGTCGGGAGAAAGTGGGAGG + Intronic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1021499709 7:21319050-21319072 CAGAGAGAGGGGAAATGGGGTGG - Intergenic
1021738956 7:23666095-23666117 CAGGGTTTGGGGAGAGTGGGTGG + Intergenic
1022026072 7:26448981-26449003 CAGAGTTTGGGGTATGTGGGTGG + Intergenic
1022141185 7:27494346-27494368 AAGAGTAGGGGGTGAGTGGGTGG - Intergenic
1022374020 7:29796714-29796736 CAGAGTCAGGTGAATGTGAGGGG + Intergenic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023644685 7:42297859-42297881 CAGAGTGTGGAGGAAGTGGGTGG - Intergenic
1026290512 7:69001797-69001819 CAGACTAATGGTAGAGTGGGTGG - Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030193277 7:106830609-106830631 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1030306097 7:108020070-108020092 CAGAGTAGGGGATAAGTGAGGGG - Intergenic
1030659171 7:112201846-112201868 CAGAGTCTGGGGGAAGAGGGTGG - Intronic
1031049659 7:116932178-116932200 AAGAGTAAGGGGGAAGGGGCAGG - Intergenic
1032004609 7:128290879-128290901 GAGAGTAAGGGGCAATGGGGAGG - Intergenic
1033591821 7:142815101-142815123 GAGAGAAAGTGGACAGTGGGTGG + Intergenic
1034202865 7:149293424-149293446 AAGAGGAAGGGGCAAGTGGGAGG + Intronic
1034245073 7:149637823-149637845 CAGAGAAATGGGTATGTGGGAGG - Intergenic
1034892345 7:154852399-154852421 AAGAGGAAGTGGGAAGTGGGTGG - Intronic
1037752550 8:21692347-21692369 AAGAGAAAGGGGAAAGGAGGAGG + Exonic
1038285716 8:26204697-26204719 AAGAGGGAGGGGAAAGTAGGGGG - Intergenic
1039721499 8:40169308-40169330 TGGGGTCAGGGGAAAGTGGGAGG + Intergenic
1039793106 8:40891238-40891260 GAGAGCAAGGGGGAAGGGGGAGG + Intronic
1039829624 8:41202444-41202466 CAGAGTGACGAGAATGTGGGTGG + Intergenic
1041121857 8:54593929-54593951 CAGAGGAAGGTGAAAGTCAGTGG + Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041424149 8:57701643-57701665 CAGAGGAAGGGGAAACCTGGAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042428982 8:68682012-68682034 GAGACTAAAGGGTAAGTGGGTGG + Intronic
1042659356 8:71136422-71136444 CAGAGCAAGGTGAAAGTTTGAGG - Intergenic
1042781908 8:72500556-72500578 GAGAGGAAAGGGAAAGTGGGGGG + Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1044068543 8:87726493-87726515 CAGAGTAAGGGAAGTGAGGGTGG + Intergenic
1045382923 8:101644752-101644774 CGGAGTAAGAGGAAAGTGTGTGG + Intronic
1046591625 8:116214184-116214206 CAGAGTAAGGTGAAAATGTGTGG + Intergenic
1046694665 8:117326184-117326206 GAGAGAAAGGGGAAATTGGCTGG + Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047421394 8:124710829-124710851 CAGAGAAAGGGCAACTTGGGAGG + Intronic
1047933475 8:129752408-129752430 CAGAGGAAGGGGACAGTTGCAGG + Intronic
1048456696 8:134584788-134584810 CGGGGGAAGGGGAAAGAGGGCGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051048468 9:12903181-12903203 CAGAGTAAGGACAAAGTAAGAGG - Intergenic
1051056338 9:12991616-12991638 CAGAAAAAGGGGATAGTAGGTGG + Intergenic
1051235481 9:14994011-14994033 CAGAGAAATGGGAAAGTAAGAGG + Intergenic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1057973497 9:99579656-99579678 CAGAGTAATGGGACAGAGAGTGG + Intergenic
1057987304 9:99730182-99730204 CAGAGGAAGGGGAGAGTGAAAGG - Intergenic
1058620504 9:106878088-106878110 CAGAGTAGTGGGAAAGTGATTGG + Intronic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1059844115 9:118252463-118252485 TAGAGTAAGTGGAAAGAGGGAGG - Intergenic
1059928168 9:119233547-119233569 GAGAGGCATGGGAAAGTGGGAGG - Intronic
1059941986 9:119368245-119368267 CAGAGAAAGGGGGAAGTCAGCGG - Intronic
1061154623 9:128850365-128850387 CAAAGTTAGGGCAAAGTGGCTGG - Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186950016 X:14614198-14614220 GAGAGTAATGGGAAAGATGGAGG + Intronic
1187742221 X:22368325-22368347 CAGAGAAAGGGAAAACTGGAGGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188345114 X:29054394-29054416 GAGACTGAGGGGTAAGTGGGAGG - Intronic
1189031969 X:37460269-37460291 CAGACTAAGGGAGAAGAGGGAGG + Intronic
1189069352 X:37847431-37847453 CAGAGGAAGGCGGGAGTGGGGGG + Intronic
1189322730 X:40096385-40096407 GAGAGGAGGGGGAAAGCGGGAGG + Intronic
1189473682 X:41333391-41333413 CGGAGTAAGGGGAAAGGAGGAGG - Exonic
1190713586 X:53086558-53086580 CAGAGATAGGAGACAGTGGGTGG + Intronic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1192764805 X:74129616-74129638 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
1193521162 X:82530519-82530541 CAGAGACAGGGGAAAGACGGAGG - Intergenic
1194660541 X:96625295-96625317 CAGACTAAGGGAGAAGAGGGAGG - Intergenic
1195074268 X:101311609-101311631 CAAAGGAAGAGAAAAGTGGGAGG - Intergenic
1195477682 X:105304994-105305016 CAGAGCAGGAGGAAAGGGGGAGG + Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1197698488 X:129576709-129576731 AAGCCTAAGGGGAAAGAGGGGGG + Intronic
1198635049 X:138688308-138688330 CAGAGTCTGGGAAAAGTAGGTGG + Intronic
1199951274 X:152708204-152708226 GGGAGTAAGGGGAAAGAGGTGGG - Intergenic
1199958409 X:152760257-152760279 GGGAGTAAGGGGAAAGAGGTAGG + Intergenic
1200007986 X:153100477-153100499 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
1200036574 X:153334944-153334966 GAGAGGCAGGGGAAAGGGGGCGG + Intronic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1200206094 X:154317455-154317477 CAGAGGAAGGGCCAAGTGGTAGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic
1201234399 Y:11895613-11895635 CAGGCTAAGGGCAAAGAGGGAGG + Intergenic