ID: 1099213599

View in Genome Browser
Species Human (GRCh38)
Location 12:79825106-79825128
Sequence TACAGGTCATTAAGAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099213599 Original CRISPR TACAGGTCATTAAGAGAAAG TGG Intronic
902568207 1:17329526-17329548 TACTGTTCATTAAGTGGAAGTGG + Intronic
902897665 1:19490182-19490204 AAGAGGTCATGAAGATAAAGAGG + Intergenic
904573052 1:31482126-31482148 TACTGTTTATTAAGAGGAAGTGG - Intergenic
906994617 1:50778610-50778632 TACTATTCATTAAGTGAAAGTGG + Intronic
907578858 1:55553854-55553876 TACAATTCATTAAGTGGAAGTGG - Intergenic
907980217 1:59473164-59473186 TACAGCTCATAAAGGCAAAGTGG - Intronic
908201777 1:61804405-61804427 TACAAATCATTAAGTGAAACAGG - Intronic
908379689 1:63584702-63584724 TACTGTTCATTAAGTGAAAGTGG - Intronic
908963033 1:69725188-69725210 TACTGTTCATTAAGTCAAAGTGG + Intronic
909614156 1:77587891-77587913 TACTATTCATTAAGTGAAAGTGG - Intronic
909726151 1:78838213-78838235 TACAGAACATTAAGATACAGAGG + Intergenic
910274813 1:85437495-85437517 TACTGTTCATTAAGTGGAAGTGG - Intronic
910411321 1:86948533-86948555 TTCTGGTCATTAAGTAAAAGAGG - Intronic
911448561 1:98033837-98033859 TACCGGTCAGTGAGAGAAGGAGG - Intergenic
911572925 1:99539656-99539678 TACTGTTCATTAAGTGGAAGTGG + Intergenic
912507699 1:110167392-110167414 TACAGGACATGATAAGAAAGTGG + Intronic
912981423 1:114376780-114376802 TCCAGGTCATTATAAGAAAAAGG - Intergenic
913058113 1:115180590-115180612 TACAAGTCATTAAGAGCAGCAGG - Intergenic
913068286 1:115277323-115277345 CAGAGGTTTTTAAGAGAAAGAGG - Intergenic
919314684 1:195956080-195956102 TACTGTTCATTAAGTGGAAGTGG + Intergenic
922177981 1:223211736-223211758 TGCAGGAGATTAAGAGGAAGGGG + Intergenic
922321725 1:224494658-224494680 AAGAGGTCTTTAAGATAAAGTGG - Intronic
923615514 1:235533984-235534006 TACTATTCATTAAGTGAAAGTGG - Intergenic
923812647 1:237336920-237336942 TACATGTCTTAAAGAGATAGGGG - Intronic
924315517 1:242791382-242791404 TACTGGTTATTAAGAGGAAGTGG + Intergenic
1065242228 10:23718207-23718229 TGCATGTCATCAATAGAAAGTGG + Intronic
1065460711 10:25960634-25960656 TACTGTTCATTAAGTGGAAGTGG + Intronic
1066433380 10:35373657-35373679 TACTATTCATTAAGTGAAAGTGG - Intronic
1066530788 10:36336668-36336690 TACAAATCATTATGAAAAAGAGG - Intergenic
1066576738 10:36834049-36834071 GAGAGGAAATTAAGAGAAAGTGG + Intergenic
1067405355 10:46018165-46018187 TACAGGTAATTAGGAAAAACAGG - Intronic
1069022516 10:63504732-63504754 AACAGGTCAATAATAGAAATAGG + Intergenic
1070367193 10:75749143-75749165 TACTATTCATTAAGTGAAAGTGG - Intronic
1070408760 10:76120070-76120092 TACAGGTAATTGAGTCAAAGGGG - Intronic
1073795796 10:106987000-106987022 TACTAGTCATACAGAGAAAGTGG - Intronic
1074759486 10:116655696-116655718 CATAGGTCCTCAAGAGAAAGAGG - Intergenic
1077531158 11:3095793-3095815 TTCCGGTGATTAAGTGAAAGAGG + Intronic
1078002417 11:7508113-7508135 TACGGTTCATTAAGTGGAAGTGG + Intronic
1078807831 11:14724297-14724319 TACAGAACATTAATAGGAAGGGG + Intronic
1079674234 11:23203871-23203893 TTCAGATCATCAAGAGAGAGAGG - Intergenic
1080557323 11:33429625-33429647 TAGAGGTCATGAAGATGAAGAGG - Intergenic
1081479745 11:43474880-43474902 TACTGTTCATTAAGTGGAAGTGG + Intronic
1082014653 11:47475805-47475827 TCTAGCTCATTATGAGAAAGTGG - Intronic
1088377447 11:109158319-109158341 TAGAGGTGACTAAGAGAATGTGG + Intergenic
1088782664 11:113151164-113151186 TTCAGGTCATTAAGAGCCAGAGG - Intronic
1088940598 11:114451420-114451442 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1091078909 11:132647610-132647632 TACTGTTCATTAAGTGCAAGTGG + Intronic
1092305417 12:7295650-7295672 TTCAGGTCATGAAGAGAAGGGGG + Intergenic
1092748966 12:11700687-11700709 TACCGTTCATTAAGTGGAAGTGG + Intronic
1093520336 12:20042769-20042791 TATAGGTCATGGAGAAAAAGTGG - Intergenic
1093682590 12:22019858-22019880 TACTGTTTATTAAGTGAAAGTGG - Intergenic
1095120177 12:38407713-38407735 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1095270996 12:40218911-40218933 TACTGTTTATTAAGTGAAAGGGG - Intronic
1095533555 12:43219791-43219813 TACAGATCATTTAGTTAAAGTGG - Intergenic
1097011540 12:55956780-55956802 TCCATGTCATTAAGAGAGACTGG + Intronic
1097382830 12:58915998-58916020 TTCAGGTCTTAAAAAGAAAGGGG + Intronic
1097475980 12:60056973-60056995 TACATGTCATTTAGAGGAAAGGG + Intergenic
1097525974 12:60736890-60736912 TTCAGAAAATTAAGAGAAAGTGG - Intergenic
1097781420 12:63710253-63710275 TACAGCTCATTTAGAGAACAAGG + Intergenic
1097908447 12:64944469-64944491 GACAGGTCCTAAAGGGAAAGAGG - Intergenic
1098005679 12:65994599-65994621 TACTATTCATTAAGTGAAAGTGG - Intergenic
1098607651 12:72412262-72412284 TACAAATCAGTAAGAAAAAGAGG + Intronic
1099107586 12:78515993-78516015 TAGATGTAATTAAGAAAAAGAGG - Intergenic
1099213599 12:79825106-79825128 TACAGGTCATTAAGAGAAAGTGG + Intronic
1099480400 12:83158578-83158600 TACAAGTCCTTGTGAGAAAGTGG - Intergenic
1101528618 12:105554688-105554710 CACAGGTCAAGAAGAGTAAGTGG + Intergenic
1101950694 12:109172423-109172445 TACAGGACAGGAGGAGAAAGAGG - Intronic
1101999377 12:109547271-109547293 TCCAGGTCGTGATGAGAAAGTGG - Intergenic
1102860727 12:116334028-116334050 AACAAGTCCTTAAGAAAAAGAGG + Intergenic
1102937995 12:116913552-116913574 TACTATTCATTAAGTGAAAGTGG + Intronic
1103279360 12:119742729-119742751 TACAGGCTATTAGGAGAAAAGGG + Intronic
1104380416 12:128302639-128302661 AACAGGGCTTTAAGAGAATGTGG + Intronic
1105005070 12:132716532-132716554 AACAGGGCATTAAGAGGCAGAGG - Intronic
1105204024 13:18204663-18204685 TACTATTCATTAAGTGAAAGTGG + Intergenic
1105650856 13:22375475-22375497 CAGAGGTCTTTAAGTGAAAGTGG + Intergenic
1106423629 13:29604865-29604887 TACTAGTCATTAAGTGAAAGTGG - Intergenic
1106845290 13:33731720-33731742 TAGTGGTCATTAGGAGAAAATGG - Intergenic
1108969728 13:56358338-56358360 TACATGTCTTTAAGAGAAAAAGG - Intergenic
1109118368 13:58420302-58420324 TAAAGGTCAATAATAGAAATCGG - Intergenic
1109400714 13:61824391-61824413 TCCCGCTCATAAAGAGAAAGGGG + Intergenic
1109996031 13:70128238-70128260 TAATGGTCATTAAGTGAAAATGG + Intergenic
1110302114 13:73940780-73940802 TAAATCTCATTAAGAGAATGAGG + Intronic
1111032554 13:82623154-82623176 TACAGTTCATTAAGTGGAAGTGG + Intergenic
1111391464 13:87600953-87600975 TACTAGTCATTAAGTGGAAGTGG + Intergenic
1111417257 13:87965155-87965177 TACGGGTCAATAAGACAAAAAGG - Intergenic
1111607370 13:90558471-90558493 TACTTGTCCTGAAGAGAAAGAGG + Intergenic
1111657537 13:91172809-91172831 TACAAGTTATTTAGAAAAAGAGG + Intergenic
1113256136 13:108508205-108508227 TACAAGGCATACAGAGAAAGAGG - Intergenic
1114335587 14:21686081-21686103 TAGAGGTCATGAAGAGAAAGAGG - Intergenic
1116993275 14:51297660-51297682 TCCAGGTGATTGTGAGAAAGGGG + Intergenic
1117384694 14:55199660-55199682 TACTATTCATTAAGTGAAAGTGG + Intergenic
1118082205 14:62373709-62373731 TATATGTCTTTAAGAAAAAGGGG + Intergenic
1118172692 14:63404191-63404213 TAAAAGTCATTAAGAGCAAAAGG + Intronic
1118610603 14:67536591-67536613 TACAGGACCCTAAAAGAAAGAGG - Intronic
1120024213 14:79564277-79564299 AAGAGGGCATTGAGAGAAAGTGG + Intronic
1120703813 14:87726921-87726943 TACTAGTCATTAAGCGGAAGTGG + Intergenic
1123993104 15:25698373-25698395 TACTATTCATTAAGTGAAAGCGG - Intronic
1124448129 15:29758005-29758027 TACTGTTCATTAGGTGAAAGTGG - Intronic
1124465103 15:29931180-29931202 TACTGTTCATTAAGTGGAAGTGG + Intronic
1124701156 15:31913425-31913447 TACTGTTCATTACAAGAAAGTGG - Intergenic
1124818335 15:33018943-33018965 TACAGCTCATAAAGACAATGTGG + Intronic
1126463384 15:48937660-48937682 TCCATATCATGAAGAGAAAGAGG + Intronic
1127305703 15:57704106-57704128 AACATTTCATTAAGAGAAAGAGG + Intronic
1129568811 15:76655889-76655911 AAAAGGTCCTTAAGAGATAGTGG + Intronic
1130247434 15:82264481-82264503 TACAGTTATTTAAGAGAATGAGG - Intronic
1130380380 15:83367051-83367073 TACTGTTCATTAAGGGGAAGTGG + Intergenic
1131104659 15:89724601-89724623 TACAGATTCTTAAGAAAAAGAGG + Intronic
1131618750 15:94044647-94044669 TATAAATCATTAAGAGAAACAGG - Intergenic
1132309699 15:100848659-100848681 ATCAGGTCATTAAGAAAACGTGG + Intergenic
1133148871 16:3811442-3811464 TACCATTCATTAAGTGAAAGTGG - Intronic
1133606439 16:7392618-7392640 TATAGGGGATTAGGAGAAAGTGG - Intronic
1134821984 16:17254308-17254330 TACTGTTCATTAAGTGGAAGTGG - Intronic
1135834357 16:25811352-25811374 TACTATTCATTAAGTGAAAGTGG - Intronic
1136062508 16:27736449-27736471 AACAGGGCAATAAGATAAAGAGG + Intronic
1136174561 16:28507978-28508000 CACAGGTCCTAAAAAGAAAGTGG - Intronic
1136604084 16:31320869-31320891 TGCAGGTAATTAATAGAAATTGG + Intronic
1137246130 16:46706666-46706688 TACTATTCATTAAGTGAAAGTGG + Intergenic
1137816174 16:51399993-51400015 TACATTTCACTGAGAGAAAGGGG - Intergenic
1139321174 16:66115575-66115597 AACAGGTCACTAAGAGGCAGTGG - Intergenic
1141767466 16:86068000-86068022 TGCAGGTCAGGCAGAGAAAGAGG + Intergenic
1143385549 17:6527966-6527988 TACTGGTGATTAGGAAAAAGAGG - Intronic
1143491644 17:7288614-7288636 TACAGGTCATTTGGAAAAACTGG + Exonic
1143754976 17:9060249-9060271 TACTGTTCATTAAGTGGAAGTGG - Intronic
1143951851 17:10638785-10638807 TATAAGCCATTTAGAGAAAGTGG - Intronic
1143982165 17:10879480-10879502 ATCAGGTAATTAAGTGAAAGGGG - Intergenic
1145818684 17:27814286-27814308 TACAATTCATTAAGTGGAAGTGG + Intronic
1146552643 17:33794974-33794996 TATAGGTCATTCAGATAATGTGG - Intronic
1146803738 17:35848652-35848674 TAAAAGTGATTAAGAGAAAGGGG - Intronic
1147524424 17:41207291-41207313 TACTGTTCATTAAGTGGAAGTGG + Intronic
1148066010 17:44870638-44870660 TACTGTTCATTAAGTGGAAGTGG - Intronic
1148594402 17:48841400-48841422 TTTAAGTCATTTAGAGAAAGGGG + Intronic
1148983524 17:51600082-51600104 TTCAGGTCATGATGAGAAGGGGG + Intergenic
1149190921 17:54060800-54060822 TACATGTCATTAAAAGCAGGGGG - Intergenic
1149669451 17:58393089-58393111 TACTATTCATTAAGTGAAAGTGG - Intronic
1150528246 17:65947199-65947221 CACAGGTCATTAAGAGAGCACGG - Intronic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1152370175 17:79882735-79882757 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1156738071 18:40287438-40287460 TGAAGGTAATAAAGAGAAAGGGG + Intergenic
1157582196 18:48780119-48780141 TACAGATCACTAAGTGTAAGAGG + Intronic
1157894655 18:51454202-51454224 TAGTGGTCATTAAGAGAGATTGG + Intergenic
1158490965 18:57909461-57909483 TACATGTGAGAAAGAGAAAGGGG - Intergenic
1159156657 18:64591977-64591999 TGGATGTCATTAAGTGAAAGGGG + Intergenic
1159753220 18:72328626-72328648 TACATTTTATTAAGTGAAAGAGG + Intergenic
1160425954 18:78779375-78779397 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1163195086 19:15713250-15713272 TACAAGTTATTTAGAGAATGTGG + Intergenic
1163811827 19:19437601-19437623 TAGAGGTCATCAGTAGAAAGGGG - Intronic
1165892280 19:39120898-39120920 TGCAGATCAATAAGAGAAAAAGG - Intergenic
1166135021 19:40771158-40771180 TACAGCTCATAAAGATAATGTGG + Intergenic
1167110138 19:47455555-47455577 TAAATGTCATTATGGGAAAGGGG + Intronic
926668588 2:15552487-15552509 TACTGTTCATTAAGTGGAAGTGG - Intronic
926892767 2:17652137-17652159 TTCAGGTATTTAAGTGAAAGAGG + Intronic
927369733 2:22340625-22340647 TACATGTCATTAAAGGAGAGGGG - Intergenic
928635511 2:33241632-33241654 TACAGGCCATTCAGGGGAAGAGG + Intronic
928639582 2:33284136-33284158 TACATGTCATGAATACAAAGAGG - Intronic
930443369 2:51437497-51437519 CACATGTCATTAAGGGAATGTGG + Intergenic
930707387 2:54518192-54518214 GACAGGTTATTAAGAAACAGTGG + Intronic
931214130 2:60225810-60225832 CACAGGTCATGAAAACAAAGAGG - Intergenic
931320419 2:61170443-61170465 TACTGTTCATTAAGGGGAAGTGG - Intergenic
931654566 2:64499250-64499272 TACAGGCCATGATGGGAAAGTGG - Intergenic
931954653 2:67407764-67407786 TACTATTCATTAAGTGAAAGTGG + Intronic
932584020 2:73011610-73011632 AACAGGTAATTCAGAGAAGGGGG + Intronic
932741930 2:74297608-74297630 GAGAGGCCATTAGGAGAAAGAGG - Intronic
933151345 2:78918802-78918824 TACAGTTCATTAAGTGGAAGTGG - Intergenic
933416198 2:81989510-81989532 TGCAGGTATTTAAGAGAGAGAGG + Intergenic
933483360 2:82885375-82885397 TAGATGTCATAAAGAGAAGGAGG + Intergenic
933485324 2:82914789-82914811 TACTAGTCATTAAGTGGAAGTGG + Intergenic
933575573 2:84063426-84063448 TACAGGTCAATAAGAGAAGAGGG - Intergenic
933776664 2:85775221-85775243 GACAGGACACAAAGAGAAAGGGG - Intronic
933830664 2:86205334-86205356 TACTGTTCATTAAGTGGAAGTGG + Intronic
934107821 2:88712069-88712091 TTCAGGTCATGATGGGAAAGGGG - Intronic
934120961 2:88839059-88839081 TAGAAGTCATGAAGAGAAAATGG - Intergenic
934127257 2:88907951-88907973 TACTAGTCATTAAGTGAAAATGG - Intergenic
935419531 2:102853189-102853211 ATCAGTTCATGAAGAGAAAGGGG - Intergenic
935470057 2:103448485-103448507 TAAAAGTCATTCAGAGCAAGTGG - Intergenic
935612244 2:105037820-105037842 TTCAGGACGTGAAGAGAAAGAGG + Intergenic
936023728 2:109015374-109015396 TACAATTCATTAAGGGGAAGTGG - Intergenic
936695269 2:114939173-114939195 TACTAGTCATTAAGTGGAAGTGG + Intronic
936825248 2:116574653-116574675 TACTGGTCTTTATGAGAAGGTGG - Intergenic
937500274 2:122470959-122470981 TTAAGGTCATTAAGAAAAAAAGG - Intergenic
937559123 2:123199328-123199350 TACAGGTAAGTAAGGGACAGAGG - Intergenic
937645012 2:124256999-124257021 GACAGGTCATTTAAAGAAAAAGG + Intronic
938625320 2:133102588-133102610 TAAAGATCCTTAAGAGAGAGCGG - Intronic
938910132 2:135877900-135877922 TCCAAGACATTAAGAGAAACGGG + Intergenic
938960260 2:136334465-136334487 TAAATGTCCTTATGAGAAAGAGG - Intergenic
941128816 2:161620959-161620981 TACTGTTCGTTAAGTGAAAGTGG - Intronic
941382646 2:164814849-164814871 GACAGGTAATTAAGAGAACTTGG - Intronic
941849917 2:170169864-170169886 AACATGTCCTTAAGAAAAAGAGG - Intergenic
942053058 2:172158609-172158631 TCTAGGTCATTAAGTCAAAGGGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943543097 2:189242054-189242076 TATAAGTCAATAAGAAAAAGAGG - Intergenic
944075944 2:195730936-195730958 TACAGGTGGTTAGGCGAAAGAGG - Intronic
944312214 2:198246072-198246094 TTCAGGTAATTAAAAGACAGAGG + Intronic
944627457 2:201586062-201586084 TACTGTTCATTAAGTGGAAGAGG - Intronic
944901009 2:204216115-204216137 TACTGTTCATTAAGTGGAAGTGG - Intergenic
944964645 2:204916740-204916762 TACAGATAATTAAGAGTATGTGG - Intronic
945660781 2:212682726-212682748 TACCGGTCATTAGTATAAAGAGG - Intergenic
945863755 2:215153675-215153697 TATAGATTACTAAGAGAAAGAGG - Intergenic
947120580 2:226810605-226810627 TACTACTCATTAAGTGAAAGTGG + Intergenic
947689128 2:232118297-232118319 TACAGGGCATGAAGACCAAGAGG + Intronic
948881350 2:240858916-240858938 TACAGGGCATCAAGTGAAAGTGG - Intergenic
948926440 2:241101699-241101721 TACTTTTCATTAAGAGGAAGCGG - Intronic
1169615738 20:7442942-7442964 TACAATTCATTACGTGAAAGTGG - Intergenic
1175092952 20:56519868-56519890 TAATGGTCATTAAAAGAAAAGGG - Intronic
1175404965 20:58719966-58719988 TCCAACTCATTAGGAGAAAGGGG - Intergenic
1176713950 21:10333417-10333439 TACTATTCATTAAGTGAAAGTGG - Intergenic
1176943216 21:14948907-14948929 TACAAGTCTTTATGAGAGAGAGG - Intergenic
1176955717 21:15100927-15100949 GACAGATCATTCAGAGCAAGAGG + Intergenic
1177068899 21:16477110-16477132 TACAAATCAATGAGAGAAAGCGG - Intergenic
1177266166 21:18787258-18787280 AATGGGTCATTAAGAGAAAGGGG - Intergenic
1177345546 21:19863877-19863899 TACTATTCATTAAGTGAAAGTGG - Intergenic
1178165706 21:29973673-29973695 TACAAATCATTAAGTGGAAGAGG - Intergenic
1178868836 21:36354123-36354145 TACTGTTCATTAAGTGGAAGTGG + Intronic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
1181770373 22:25120746-25120768 TAAAGGATATAAAGAGAAAGAGG - Intronic
1182187655 22:28423704-28423726 CACAGGCCATTATGACAAAGAGG + Intronic
1184151323 22:42640805-42640827 TACTATTCATTAAGAGGAAGTGG - Intronic
1184462117 22:44644938-44644960 TACAATTCATTAAGTGGAAGTGG + Intergenic
949121097 3:385335-385357 TATATGTCATAAAGAGAAACTGG + Intronic
949329089 3:2901436-2901458 TACATGACAGGAAGAGAAAGGGG + Intronic
950592173 3:13945716-13945738 GACAGGTCATCAAGAGAGAAAGG - Intronic
951107551 3:18762583-18762605 TTCAGGTAATTAAGAGAAGTCGG + Intergenic
951272658 3:20645756-20645778 TACATGTCATCCAGAGAAATAGG - Intergenic
951471942 3:23065840-23065862 GTCTGGTCTTTAAGAGAAAGAGG - Intergenic
952258617 3:31717028-31717050 TACAAGTCATTAGAAGCAAGAGG + Intronic
952403890 3:32988319-32988341 AATTGGTCACTAAGAGAAAGAGG + Intergenic
952656562 3:35793369-35793391 TAGAGGTCATTGAGAGAGAAGGG + Intronic
952741737 3:36740672-36740694 TCCAGGTCAGGAAGAGAAATTGG + Intergenic
953209679 3:40864574-40864596 TGCAGGTGATTAAGTCAAAGGGG + Intergenic
953209684 3:40864601-40864623 TGCAGGTGATTAAGTCAAAGGGG + Intergenic
953209689 3:40864628-40864650 TGCAGGTGATTAAGTCAAAGGGG + Intergenic
953812549 3:46126397-46126419 TACATGACATTAATAGAATGAGG + Intergenic
954231629 3:49222328-49222350 TACAGGTAATTAGGAGCTAGGGG + Intronic
955562091 3:60202413-60202435 GACAATTCATAAAGAGAAAGGGG + Intronic
955640906 3:61082967-61082989 TACACATCAGTAAGAAAAAGAGG - Intronic
956189111 3:66591661-66591683 TAAATGTCTCTAAGAGAAAGAGG + Intergenic
956330726 3:68104163-68104185 TTCTGGTCATTAAGAGGCAGAGG + Intronic
956495004 3:69815469-69815491 TACTAATCATTAAGTGAAAGTGG - Intronic
956545736 3:70400142-70400164 TACATGTAATCAAGAAAAAGGGG + Intergenic
957011534 3:75011245-75011267 TTCAGGTCATTCAGTGAAAAAGG + Intergenic
957390344 3:79558325-79558347 TACTGTTCATTAAGTGTAAGTGG - Intronic
957548724 3:81675990-81676012 TACTATTCATTAAGTGAAAGTGG - Intronic
959379827 3:105628624-105628646 TAAAGGTTATTAAAAGAAAAGGG - Intergenic
960893820 3:122480033-122480055 TACATATTATTAAGTGAAAGAGG + Intronic
961599211 3:128046121-128046143 AACAGGTGGTGAAGAGAAAGTGG - Intergenic
962162652 3:133015213-133015235 TACTGTTCATTAAGTGGAAGTGG - Intergenic
962256572 3:133873956-133873978 TACTGTTCATTAAGTGAAAGTGG + Intronic
963839176 3:150087713-150087735 TACAAATCAATAAGAAAAAGGGG + Intergenic
964830014 3:160873843-160873865 TACACGTCACTATGAGAAAATGG + Intronic
968138970 3:196240723-196240745 TCCAGATCATAAAGAGAAAAGGG + Intronic
969200911 4:5605013-5605035 TACTGTTCATTAAGTGGAAGTGG - Intronic
970359522 4:15294640-15294662 TTTAGGACATTAAGACAAAGAGG - Intergenic
970659798 4:18271922-18271944 TACAAATCATTATGAAAAAGGGG - Intergenic
970817738 4:20178346-20178368 TACAGCTCATAAAGACAATGTGG + Intergenic
971627339 4:28938782-28938804 TACAAGCCATCAAGAGATAGTGG + Intergenic
971907203 4:32742161-32742183 TTGAGGTCATTTTGAGAAAGTGG - Intergenic
972478131 4:39472230-39472252 TACTAGTCATTAAGTGGAAGTGG + Intronic
972827382 4:42775630-42775652 TACATGGCAGTAGGAGAAAGAGG + Intergenic
973960034 4:56100609-56100631 CAGAGGTAATTAAGTGAAAGTGG + Intergenic
973965097 4:56153729-56153751 TACATTTCAGCAAGAGAAAGAGG - Intergenic
974475840 4:62378807-62378829 TAGAGGCCAATAAGAGAAATAGG + Intergenic
974652023 4:64766567-64766589 TACAGATCATCATGAGAAGGTGG + Intergenic
974686977 4:65243053-65243075 TACTATTCATTAAGTGAAAGAGG + Intergenic
974803806 4:66854692-66854714 TAGATGTCAGTATGAGAAAGAGG - Intergenic
976426853 4:84913970-84913992 TACCATTCATTAAGTGAAAGTGG - Intronic
976429152 4:84943121-84943143 TACTGTTCATTAAGTGGAAGTGG - Intronic
976602903 4:86954755-86954777 TACTGTTCATTAAGTGGAAGTGG + Intronic
976688750 4:87845591-87845613 TACAGATCTTCAAGAGAGAGGGG + Exonic
977826651 4:101540653-101540675 TACAAGCCATTCAAAGAAAGAGG + Intronic
978011799 4:103695430-103695452 TACTATTCATTAAGTGAAAGTGG - Intronic
979923441 4:126528972-126528994 TACTACTCATTAAGAGGAAGTGG - Intergenic
980510889 4:133786156-133786178 TACCATTCATTAAGTGAAAGTGG + Intergenic
982461597 4:155676238-155676260 TACAGGGCTTAAATAGAAAGAGG + Intronic
982806898 4:159777307-159777329 AGCAGCTCATTAGGAGAAAGAGG - Intergenic
983375788 4:166926406-166926428 TACATGTTTTTAAGAGAAAATGG + Intronic
983539651 4:168895590-168895612 TACAATTCATTAAGTGGAAGTGG + Intronic
983993777 4:174156351-174156373 TAAAAGTCAATAAGAGAGAGTGG + Intergenic
984675806 4:182546082-182546104 TACTGTTCATTAAGTGGAAGTGG + Intronic
985616411 5:924824-924846 TTCAGGTGATAAAGAAAAAGCGG - Intergenic
985943698 5:3160147-3160169 TACAGGTTAGTAAGAAGAAGAGG + Intergenic
986668448 5:10123488-10123510 TACAGATCATTAAAACACAGTGG - Intergenic
986947169 5:13036767-13036789 TACAGGTAAGTAAGAGAAGGAGG + Intergenic
989462354 5:41715150-41715172 TATTAGTCATTAAGTGAAAGTGG + Intergenic
990137931 5:52669699-52669721 TCCATGCCATTAAGAGAAACAGG + Intergenic
990538030 5:56743140-56743162 TATAGTTGATTAAGAGTAAGCGG + Intergenic
990997832 5:61750954-61750976 TACAGCTCATTAAGTAGAAGTGG + Intronic
992079609 5:73222788-73222810 TACAGGGCAAGAAGAGAAAGAGG - Intergenic
993327441 5:86559558-86559580 TACTATTCATTAAGTGAAAGTGG - Intergenic
993930068 5:93926979-93927001 TTTAGGTCATTGAGAGAAAAAGG + Intronic
993989613 5:94639729-94639751 TACTATTCATTAAGTGAAAGTGG + Intronic
995251968 5:110003878-110003900 TACTATTCATTAAGTGAAAGTGG - Intergenic
996628502 5:125599735-125599757 TACTATTCATTAAGTGAAAGTGG + Intergenic
996788033 5:127262067-127262089 CAAAGGGCATTAAGAAAAAGTGG - Intergenic
997483004 5:134203612-134203634 GACAGGTAATTAAGGTAAAGTGG - Intronic
999173585 5:149616114-149616136 ATGAGGTCACTAAGAGAAAGTGG + Intronic
1000161905 5:158606027-158606049 TACTGTTCATTAAGTGGAAGTGG + Intergenic
1000240831 5:159406560-159406582 TACAAGTCATTTAGAGAAATGGG - Intergenic
1000887367 5:166762148-166762170 TACAGGTTTTTAATAAAAAGGGG + Intergenic
1000930227 5:167242611-167242633 TACTATTCATTAAGTGAAAGTGG - Intergenic
1001383678 5:171320424-171320446 TACTGTACATTAAGTGAAAGTGG - Intergenic
1001571062 5:172730923-172730945 TACTGTTCATTAAGCGGAAGTGG - Intergenic
1003672675 6:8173947-8173969 CACAGGTCATCAAGAGTCAGGGG - Intergenic
1004537366 6:16515614-16515636 GACAGCTCATAGAGAGAAAGGGG - Intronic
1004918551 6:20355192-20355214 TACTATTCATTAAGTGAAAGTGG - Intergenic
1005801300 6:29427953-29427975 TAGAGGTGATTATGCGAAAGAGG - Intronic
1006560390 6:34906319-34906341 GAAAGGTCAAGAAGAGAAAGAGG + Intronic
1006641910 6:35494003-35494025 TACACGTCCATAAGAGAAACTGG - Intronic
1007581466 6:42962738-42962760 TAGGGGTCAGGAAGAGAAAGAGG - Intronic
1007732859 6:43959938-43959960 TACTATTCATTAAGTGAAAGTGG - Intergenic
1008139962 6:47821021-47821043 TACGGTTCATTAAGTGGAAGTGG + Intronic
1008265024 6:49414478-49414500 TACTATTCATTAAGTGAAAGCGG - Intergenic
1008861413 6:56153819-56153841 TACAGGTGAAAAAGAGAAAGTGG - Intronic
1009056793 6:58345975-58345997 TACTAGTCATTAAGTGGAAGTGG - Intergenic
1009234448 6:61105594-61105616 TACTAGTCATTAAGTGGAAGTGG + Intergenic
1010107404 6:72185942-72185964 TACTAGTCATTAAGTAAAAGTGG - Intronic
1010522760 6:76861249-76861271 TACAGATTACTAAGAGAAACAGG + Intergenic
1010887070 6:81256987-81257009 TAAATGTCAACAAGAGAAAGTGG + Intergenic
1011046217 6:83086333-83086355 TACTGTTCATTAAGTGGAAGTGG + Intronic
1012266089 6:97144626-97144648 TACAGGGTATTTAGGGAAAGTGG + Exonic
1012857023 6:104514207-104514229 TACAAATCATTAAGTGGAAGTGG + Intergenic
1014445537 6:121523058-121523080 TACATTTCATTCAGAGACAGAGG + Intergenic
1016368840 6:143349650-143349672 TATAGGACATTAAGTGAAATAGG - Intergenic
1016611206 6:145991803-145991825 TACAAGTCTATAAGATAAAGAGG - Intergenic
1017352706 6:153460855-153460877 TGCAAGTCATTAAAAAAAAGTGG - Intergenic
1019135985 6:169907964-169907986 TGCAGGACATTAGGAGAAACAGG + Intergenic
1019836335 7:3388850-3388872 TACAGATGATAAAGAGAAGGTGG + Intronic
1020970950 7:14937841-14937863 TACTATTCATTAAGTGAAAGTGG - Intronic
1021334623 7:19384436-19384458 TACATGTCATAGAGAGTAAGAGG + Intergenic
1022295567 7:29048616-29048638 GACAGGTCATCAAGAGAGAAAGG + Intronic
1022400744 7:30034601-30034623 TACTGTTCATTAAGTGGAAGTGG + Intronic
1022940017 7:35226372-35226394 TACAGCTCATTTAGAGAACAAGG + Intronic
1023386719 7:39665271-39665293 TACTAGTCATTAAGTGAAAGTGG - Intronic
1023761788 7:43471116-43471138 TTGGGGACATTAAGAGAAAGTGG - Intronic
1024032884 7:45479607-45479629 TAAAGGTAAGTAAGAGAAAGGGG + Intergenic
1024181329 7:46898268-46898290 TAAAGGTTATTAATAGAATGTGG - Intergenic
1024850584 7:53711180-53711202 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1027000584 7:74650807-74650829 TACAAGTTATTTTGAGAAAGAGG + Intergenic
1027472209 7:78587441-78587463 TGCAGTTCATTAAAAAAAAGTGG + Intronic
1028606486 7:92661599-92661621 TACTATTCATTAAGAGGAAGTGG + Intronic
1028770821 7:94618764-94618786 TTCAGGTCATTAATGGGAAGTGG + Exonic
1029874465 7:103734622-103734644 TACAGATCATCAAGTGAGAGGGG + Intronic
1030002708 7:105082519-105082541 TACTGTTCATTAAGTGGAAGTGG + Intronic
1030021599 7:105280638-105280660 AACAAGTCATTAAAAAAAAGGGG + Intronic
1030241983 7:107337504-107337526 TGCAAGTCATTAAGTGAAACAGG + Intronic
1030791044 7:113729447-113729469 TACTACTCATTAAGTGAAAGTGG - Intergenic
1031050536 7:116940406-116940428 TACCATTCATTAAGTGAAAGTGG - Intergenic
1031060685 7:117048089-117048111 TACTGTTCATTAAGTGGAAGTGG + Intronic
1031435464 7:121727537-121727559 TAGAAGCCAATAAGAGAAAGTGG - Intergenic
1031855923 7:126922624-126922646 TTAAGGTCATTAAGTGGAAGTGG + Intronic
1032989098 7:137371221-137371243 TACAGGACATTAATATCAAGGGG + Intergenic
1037345341 8:17893516-17893538 TTCAGGACATCAAGAGACAGAGG - Intronic
1037345406 8:17894996-17895018 TTCAGGACATCAAGAGACAGAGG - Intronic
1039320717 8:36427544-36427566 TACAGGTAATCAAGAGATACAGG - Intergenic
1041206114 8:55499292-55499314 TAGAGGTCCTTTAAAGAAAGGGG + Intronic
1042389423 8:68216178-68216200 TACTGATAATTAAGAAAAAGAGG - Intronic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1043132059 8:76473727-76473749 TATATTTCATTAAGTGAAAGTGG - Intergenic
1043962946 8:86438180-86438202 TACTGTTCATTAAGTAAAAGTGG + Intronic
1044247006 8:89960231-89960253 TAGAGGTCACATAGAGAAAGTGG - Intronic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1046286783 8:112103691-112103713 TACACATCATTAACAGAAGGTGG - Intergenic
1048462390 8:134632212-134632234 TACTGTTCATTAAGTGGAAGTGG - Intronic
1048480098 8:134781817-134781839 TACACTTCATTAAGTGAAAGTGG - Intergenic
1049416460 8:142497732-142497754 AAGAGGACATTCAGAGAAAGGGG - Intronic
1051188851 9:14489138-14489160 TTCAGATCTTGAAGAGAAAGAGG - Intergenic
1051252983 9:15180998-15181020 AGCATGTCATTAAGAGAAAAAGG + Intronic
1052039502 9:23721749-23721771 TACTGTTCATTAAGTGGAAGTGG - Intronic
1053330130 9:37198081-37198103 AACAGGTTATTTAGAGAAAGAGG - Intronic
1055653524 9:78431487-78431509 TACAGCTCATTAAGATAGTGTGG - Intergenic
1056898484 9:90575034-90575056 TACAGATAAGTAAGAGAAGGAGG + Intergenic
1057059411 9:91990159-91990181 TACTGCTCATCAAGTGAAAGTGG + Intergenic
1058291192 9:103242223-103242245 TACAGTTCATTAAAAGAATGAGG + Intergenic
1058660974 9:107268466-107268488 TACTATTCATTAAGTGAAAGTGG - Intergenic
1058824664 9:108764290-108764312 TACTATTCATTAAGTGAAAGTGG - Intergenic
1059939396 9:119343316-119343338 AACACATCAGTAAGAGAAAGCGG + Intronic
1060452433 9:123755711-123755733 TACTGTTCATTAAGTGGAAGTGG - Intronic
1061645394 9:131996815-131996837 TACTGTTCATTAAGTGGAAGTGG - Intronic
1185937881 X:4279599-4279621 TACTGTTCATTAAGAGGAACTGG - Intergenic
1187342767 X:18436165-18436187 TACTATTCATTAAGAGGAAGTGG + Intronic
1188357710 X:29212786-29212808 TACTGTTCATTAACTGAAAGAGG + Intronic
1189884842 X:45531798-45531820 TGCTGGTCATTAAGTGGAAGTGG - Intergenic
1190145450 X:47887573-47887595 AACAGGGCATCAAGAGAAAGAGG + Intronic
1190772295 X:53525469-53525491 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1191025734 X:55911162-55911184 TACTATTCATTAAGTGAAAGTGG + Intergenic
1192035820 X:67561906-67561928 TACAGTTCAGTAAACGAAAGAGG + Intronic
1194109445 X:89814850-89814872 TTCAGTTCATTAACAGAATGTGG + Intergenic
1194696579 X:97059714-97059736 TACTGTTCATTAAGTGGAAGTGG + Intronic
1196080930 X:111630121-111630143 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1197628851 X:128834492-128834514 GACAGGCCCTGAAGAGAAAGGGG - Intergenic
1198260775 X:134962908-134962930 TATAGGTCCTTAAGGTAAAGGGG - Intergenic
1198763069 X:140053924-140053946 TACAGTTAATGAAGAGTAAGAGG - Intergenic
1199641338 X:149865332-149865354 TACTATTCATTAAGTGAAAGTGG + Intergenic
1199984488 X:152940972-152940994 TTCAGGTCATGATGAGAAAGGGG - Intronic
1200462110 Y:3469592-3469614 TTCAGTTCATTAACAGAATGTGG + Intergenic
1201219146 Y:11749741-11749763 TACTGGTTATTAAGAGGAAGTGG + Intergenic
1201351643 Y:13049988-13050010 CACAGGTCATATAGTGAAAGAGG - Intergenic
1201721402 Y:17101746-17101768 TACTGTTCATTAAGAGGAACTGG - Intergenic
1202127133 Y:21578465-21578487 TATAGATCATCAAGAGCAAGTGG + Intergenic