ID: 1099214167

View in Genome Browser
Species Human (GRCh38)
Location 12:79834016-79834038
Sequence GTATATATTAAATGTATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099214167_1099214172 21 Left 1099214167 12:79834016-79834038 CCATCCATACATTTAATATATAC 0: 1
1: 1
2: 4
3: 43
4: 448
Right 1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG 0: 1
1: 0
2: 1
3: 11
4: 70
1099214167_1099214169 0 Left 1099214167 12:79834016-79834038 CCATCCATACATTTAATATATAC 0: 1
1: 1
2: 4
3: 43
4: 448
Right 1099214169 12:79834039-79834061 TGAGCACCTACTATTTTGCCAGG 0: 1
1: 3
2: 9
3: 57
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099214167 Original CRISPR GTATATATTAAATGTATGGA TGG (reversed) Intronic
900868361 1:5284574-5284596 ATACATATTATATGTATGGATGG + Intergenic
901708129 1:11092091-11092113 GTATGTAATAAATATATAGATGG + Intronic
903247667 1:22027972-22027994 CTATGTATTATATGTCTGGAAGG + Intergenic
904272659 1:29360713-29360735 GTATATATTTAATATATTTATGG - Intergenic
904668037 1:32139128-32139150 GTATATAATAAATATTTGAATGG + Intronic
906743300 1:48203705-48203727 GTATATATGCAATATATGAATGG + Intergenic
907043007 1:51280305-51280327 ATATGTATTAAATGAAGGGAAGG + Intergenic
908428861 1:64036263-64036285 GTTTATATTTACTGGATGGATGG - Intronic
908791081 1:67782242-67782264 GTCTTTATTAGATGTTTGGAGGG + Intronic
909028570 1:70511594-70511616 ATATTTATTTAATGTATGAATGG - Intergenic
909220816 1:72958766-72958788 GTATAAATTAAATGTAAAAAAGG - Intergenic
909619930 1:77656092-77656114 GTAAAAATTAAATATATAGATGG - Intronic
909997843 1:82302866-82302888 GTATATATTTAAGGTATAAAAGG + Intergenic
910376157 1:86573821-86573843 GTTTATTTTAAATGGATGGTAGG + Intronic
911325384 1:96465282-96465304 ATAAATATTGAATGAATGGATGG + Intergenic
911457599 1:98146483-98146505 GTATATATTATATATATAGATGG + Intergenic
911559119 1:99382483-99382505 TTAAATATTAAATGAATGAATGG - Intergenic
912143013 1:106754824-106754846 AAATATATTCAATGTTTGGATGG + Intergenic
912213500 1:107580840-107580862 GGATATATTATCAGTATGGATGG - Intronic
912312582 1:108638855-108638877 GTATATTTTAAATGTTTGTGTGG + Exonic
912547657 1:110462579-110462601 GTATATTTTAAATGGGTGAATGG + Intergenic
913000487 1:114575495-114575517 GTACATTTTAAAAGTATGGGAGG - Intronic
913302856 1:117390935-117390957 GTATACTTTAAATGGGTGGATGG - Intronic
913419101 1:118643976-118643998 GAAGTTATTAAATGTATGAAAGG - Intergenic
915963745 1:160288462-160288484 ATATATATAAAATTTCTGGAAGG + Intergenic
916890174 1:169106293-169106315 GTATATAGTAAAGGTAGGGCGGG + Intronic
917303519 1:173603837-173603859 GTATATATCAAAAATATAGAAGG - Intergenic
917614725 1:176730023-176730045 GTATATTTTAAACGTATTGTTGG + Intronic
917999983 1:180484763-180484785 GTATATACAAAATGTGTGTATGG + Intronic
918335927 1:183512904-183512926 TTATATATTAAATTAATGGAAGG + Intronic
918996548 1:191768836-191768858 GATTATTTTAAATATATGGAAGG - Intergenic
919945151 1:202313716-202313738 ATACATAATAAATGTATGTATGG + Intronic
921410743 1:214834308-214834330 ATATATATTATATGTATATAAGG + Intergenic
921666536 1:217879402-217879424 GTATAGAATAAATGTATGCAAGG - Intergenic
922307328 1:224355864-224355886 GTATTTGTTAAATGAATGAATGG + Intergenic
923358321 1:233182616-233182638 GTATATCCTAAATGTGAGGAAGG - Intronic
923701739 1:236306303-236306325 CTATATATACAATATATGGAAGG + Intergenic
924404808 1:243731271-243731293 ATTTATCTTAAACGTATGGATGG - Intronic
924689870 1:246336574-246336596 GAACATATTAAAATTATGGAAGG + Intronic
924910477 1:248506518-248506540 CTATAAATTACATGTAAGGAAGG - Intergenic
1062846533 10:711485-711507 GTGTATATTAAATGTATGAAAGG - Intergenic
1063924463 10:10963643-10963665 ATATATATCAAATATATGGCAGG - Intergenic
1064019295 10:11796385-11796407 GTTTGTGTTAAATGTATGGCTGG + Intergenic
1065501894 10:26391545-26391567 GTATACACTAAATATATGCAGGG - Intergenic
1066011994 10:31202907-31202929 ACGTATATTAAATGTATGTATGG + Intergenic
1066094816 10:32061901-32061923 TTATAAATTAAATGGTTGGAGGG + Intergenic
1066151750 10:32629135-32629157 GCAAATATTAAATGTCTGAAGGG - Intronic
1067126327 10:43518683-43518705 ATATCTATTAGATGGATGGATGG + Intergenic
1067174821 10:43938217-43938239 GTAGATAGTAAATATATGGATGG + Intergenic
1069020769 10:63485970-63485992 GAAGATATTAAATGGATGGATGG + Intergenic
1069033818 10:63627680-63627702 TTATATAATACATGTATGGAAGG - Intergenic
1070266936 10:74912354-74912376 GGATAGATTAAATGGATGGATGG + Intronic
1070584535 10:77752475-77752497 GTATATATTAACAGCATGGTGGG - Intergenic
1071170423 10:82857614-82857636 GTTTATTTTACATATATGGAAGG + Intronic
1072058459 10:91784610-91784632 GTAGAGATTATATATATGGAAGG - Intergenic
1072496576 10:95967089-95967111 ATATATATTAAATGAGTGAATGG + Intronic
1074726889 10:116320132-116320154 TTATGTATTAAATATATGGTTGG + Intergenic
1075770279 10:124928476-124928498 GTATATATTAGAAGTGTTGAAGG + Intergenic
1075883551 10:125876440-125876462 GTATCTATTAAATGATTGGAGGG + Intronic
1077735743 11:4788855-4788877 GCATGTATTGAATGGATGGATGG + Intronic
1077786682 11:5391516-5391538 ATAAATATTAAATGTATGCGTGG + Intronic
1078161558 11:8844019-8844041 TTAAATATTAAATGTAAGGAGGG - Intronic
1078822995 11:14901166-14901188 TTAAATAGTAAATGTATGGCTGG - Intergenic
1080376618 11:31720669-31720691 GGATATTTTAAATGTTTGGTTGG - Intronic
1080460927 11:32454335-32454357 ATATATCTTGAATGGATGGATGG - Intergenic
1081000810 11:37668257-37668279 GTATATAATATATGTATATACGG - Intergenic
1081501140 11:43667857-43667879 GTATTTATTAAATGTATATGAGG + Intronic
1082138541 11:48579108-48579130 GAAGTTATTAAATGTATGAATGG + Intergenic
1082624475 11:55466451-55466473 GAAGTTATAAAATGTATGGATGG + Intergenic
1083718942 11:64594613-64594635 GTATAGATGAATTGAATGGATGG + Intronic
1085775161 11:79358808-79358830 GTATTTATTGAATGAATGGCAGG - Intronic
1085933742 11:81118811-81118833 ATATAAAATAAATGTATGCATGG + Intergenic
1086803864 11:91214699-91214721 TTATTTATTTAATGAATGGATGG + Intergenic
1087711888 11:101563602-101563624 TTATAAATTAAATGAATGTATGG - Intronic
1087779564 11:102288070-102288092 GCAAATATTAAATGGATGGCTGG + Intergenic
1089019922 11:115202829-115202851 ATATATATTAAATATATGGTGGG + Intronic
1089105366 11:115998790-115998812 GTATATATGACAGGTAGGGATGG + Intergenic
1090789660 11:130080499-130080521 GTATAAATAAAATGTCTGGCCGG - Intronic
1092754999 12:11755073-11755095 GTAAATATTTATTGGATGGATGG + Intronic
1093851361 12:24043428-24043450 ATATATATTTATTGTATGGTGGG - Intergenic
1095276121 12:40284653-40284675 GTACATATTATGTGTATTGATGG + Intronic
1097167997 12:57095856-57095878 GGATATGTTAAATGTATAGCTGG - Exonic
1097497605 12:60360748-60360770 ATATATATTATATGTATAGTGGG + Intergenic
1098540083 12:71645293-71645315 GTATATATGTAATGTAGGGTTGG + Intronic
1098563546 12:71904832-71904854 GTATAAAATAATTGTATGAATGG + Intronic
1099214167 12:79834016-79834038 GTATATATTAAATGTATGGATGG - Intronic
1100573623 12:95867825-95867847 GTATACATTAAATGTATAAGTGG + Intronic
1101283047 12:103279347-103279369 GCATACATTAAATATATGCAGGG + Intronic
1101763263 12:107676539-107676561 GTAAATATTGAATGAATGAATGG - Intergenic
1102927685 12:116839286-116839308 GTAAATATTGGATGGATGGATGG + Intronic
1104417109 12:128604750-128604772 ATAGATAATAAATGGATGGATGG + Intronic
1104651676 12:130539226-130539248 TTATATAATACATGTATGTAGGG - Intronic
1105320742 13:19319110-19319132 GTATTTATTAAATGAGTGAATGG - Intergenic
1105510549 13:21048518-21048540 GTATTTAATAAATGTTTGTATGG - Intronic
1106023298 13:25934583-25934605 ATATGTATTAAATGAAGGGAAGG + Intronic
1106454780 13:29917608-29917630 CTATAAATTAAATGAATGTATGG + Intergenic
1106464789 13:30003580-30003602 CTATATATTAGATGGATGGATGG - Intergenic
1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG + Intronic
1107117312 13:36761162-36761184 CTATATCTTACATGTATTGACGG - Intergenic
1107133873 13:36923046-36923068 ATATAGATAAAATTTATGGACGG + Intergenic
1107201384 13:37722896-37722918 GTATATGTGAAATATTTGGATGG + Intronic
1107583189 13:41814698-41814720 GTATCTGTTAAATAAATGGATGG - Intronic
1107889196 13:44899368-44899390 GTAGATATTAAATTTGTGGTAGG - Intergenic
1107920908 13:45206193-45206215 GTATATAATCAATGTATCCAGGG - Intronic
1108029048 13:46209481-46209503 GTTTATATTAATTATATGTACGG - Intronic
1108082660 13:46753185-46753207 GTATATGTTATATGTATGTATGG + Intergenic
1108142728 13:47442338-47442360 GTGTATATCAAATGTATGGATGG + Intergenic
1109050497 13:57474816-57474838 ATATTTATTAAATGAATGAATGG + Intergenic
1109530194 13:63632792-63632814 GTATATAAGAAAAGTCTGGATGG - Intergenic
1109582205 13:64355481-64355503 GGAAATATGTAATGTATGGAGGG - Intergenic
1109671446 13:65613639-65613661 GGTTATATTAAGTGTTTGGAAGG + Intergenic
1109674102 13:65650964-65650986 TTATTTATTAAATGTATTGATGG - Intergenic
1109972894 13:69793075-69793097 TTATATATTAAATATATGGTAGG - Intronic
1109993468 13:70089589-70089611 GTATATATAAATTTTATAGATGG + Intronic
1110162354 13:72393532-72393554 AAATATATTGAATGAATGGATGG + Intergenic
1110514785 13:76397226-76397248 CTATATATAATATGTATGTATGG - Intergenic
1110882372 13:80587932-80587954 GAATATACTAAAGGCATGGAAGG + Intergenic
1110929845 13:81201707-81201729 GTATAGAATAAATGGTTGGAGGG - Intergenic
1111070087 13:83154736-83154758 TTATATATTAAATGTATGTTTGG - Intergenic
1111205829 13:85010172-85010194 ATATATATTCAATGAATGGATGG - Intergenic
1111347641 13:86981839-86981861 GTATATATAAAATATATCAAAGG - Intergenic
1111390308 13:87585562-87585584 TTATATATTAAATTTATAGGTGG - Intergenic
1111624897 13:90772198-90772220 GTATATCTTACATATATTGATGG + Intergenic
1111801906 13:92991575-92991597 TTATATATTTATTGTATGCAGGG + Intergenic
1111896218 13:94145110-94145132 ATATTTATTAAATGACTGGATGG + Intronic
1114829134 14:26118152-26118174 GGATATAGAAAATGTATGCATGG + Intergenic
1116196307 14:41730900-41730922 GTATATGTTAATTGAATGAAAGG + Intronic
1116556928 14:46322806-46322828 GGATAAATTAAATGAAAGGATGG + Intergenic
1117169019 14:53071404-53071426 ACATTTATGAAATGTATGGAAGG - Intronic
1117613269 14:57505834-57505856 TTCTTCATTAAATGTATGGAGGG - Intergenic
1118939100 14:70316173-70316195 ATATTTATTGAATGAATGGATGG - Intergenic
1120017812 14:79494081-79494103 GTATGCATTAAATGTATAGTTGG + Intronic
1120099834 14:80431954-80431976 GTATTTGTTTAATGAATGGAAGG + Intergenic
1121247690 14:92474275-92474297 ACACATATTAAATGTATGGGAGG - Intronic
1122567361 14:102669907-102669929 GGATATATTGAAAGTATGGGTGG + Intronic
1122600847 14:102920981-102921003 GTGAATATTAAGTGGATGGATGG - Intergenic
1123465895 15:20515437-20515459 GTATATGTAAAGTGTATGTATGG + Intergenic
1123572826 15:21632136-21632158 GTGTTTGTTAAATGGATGGATGG - Intergenic
1123609446 15:22074723-22074745 GTGTTTGTTAAATGGATGGATGG - Intergenic
1123652219 15:22485602-22485624 GTATATGTAAAGTGTATGTATGG - Intergenic
1123903408 15:24898601-24898623 GTATATATTGAAAGTATAAAGGG + Intronic
1124276618 15:28331411-28331433 GTATATGTAAAGTGTATGTATGG + Intergenic
1124306083 15:28580196-28580218 GTATATGTAAAGTGTATGTATGG - Intergenic
1125030037 15:35066990-35067012 ATATTTCTTAAATGGATGGATGG - Intergenic
1125196255 15:37050331-37050353 GCTTTTATTAAATGAATGGATGG + Intronic
1126346874 15:47705027-47705049 ATATATATTTATTGAATGGATGG - Intronic
1126442858 15:48710817-48710839 GAATATATTGAATGTATTCAAGG + Intergenic
1126588550 15:50315776-50315798 CTATATATTAAAATTCTGGACGG + Intronic
1127013788 15:54660070-54660092 GGATATATTATATGTATAGCAGG - Intergenic
1127248053 15:57199777-57199799 GTATATATTAAATGTTATTAAGG + Intronic
1127880260 15:63151001-63151023 ATTTATATTAAGTTTATGGAAGG + Exonic
1128262283 15:66240903-66240925 GTATGTATTAGATGTTTGAAAGG + Intronic
1129574789 15:76731512-76731534 GTAAAAATAAAATGGATGGAGGG + Intronic
1130159765 15:81386768-81386790 GTATATATTTAATATCTGGTGGG - Intergenic
1130449787 15:84039543-84039565 GTATATATTTATTATATGAAAGG + Exonic
1131030335 15:89180924-89180946 GTATATATTAAAAGTAGGGAAGG + Intronic
1131467889 15:92670102-92670124 GTAAAGATTAAATGCATGTAGGG + Intronic
1131796606 15:96023862-96023884 ATATATATTAAATGTATAGATGG + Intergenic
1202981687 15_KI270727v1_random:366508-366530 GTGTTTGTTAAATGGATGGATGG - Intergenic
1133720400 16:8489321-8489343 GTATAAATTAAATTTTTGTAAGG + Intergenic
1134423682 16:14117845-14117867 GTCTATATTAAACCTATGAATGG - Intronic
1135128177 16:19829004-19829026 ATATATATTATATATATGCATGG + Intronic
1135883804 16:26285470-26285492 GCATTTGTTAAATGAATGGATGG + Intergenic
1136005886 16:27328559-27328581 ACATATATTAAATGAATGAATGG - Intronic
1136345752 16:29674620-29674642 GTATATGTTTACTGAATGGAGGG + Intronic
1137386199 16:48044534-48044556 GAATGCATGAAATGTATGGATGG - Intergenic
1137612112 16:49825430-49825452 GTATATATTATATATATGTATGG - Intronic
1137810200 16:51345285-51345307 GTAAATATTATCTGGATGGACGG + Intergenic
1138440294 16:57030257-57030279 GTATATATTGAATTAATGGATGG + Intronic
1138721247 16:59082932-59082954 GTATATACTAAAACCATGGAAGG - Intergenic
1140648600 16:77062936-77062958 GTATATTTTATCTGTAAGGACGG - Intergenic
1141046026 16:80716848-80716870 GTATGTAATGTATGTATGGATGG + Intronic
1141203667 16:81915975-81915997 ATATTTTTTAAATGTCTGGATGG - Intronic
1141263549 16:82475439-82475461 GTAAATATTAAATATATCAAGGG + Intergenic
1143968059 17:10771116-10771138 GTATTTATTGAATGGATGCATGG + Intergenic
1145199286 17:20927315-20927337 GAAAATACTAAATGTATGTAAGG - Intergenic
1145290322 17:21539695-21539717 ATATATAATAAATATTTGGAGGG - Intronic
1146722912 17:35135790-35135812 CTGTATATTAAATCTCTGGAAGG + Intronic
1146826751 17:36029696-36029718 ATTTATATTAAATGGATGGACGG - Intergenic
1146899979 17:36577844-36577866 GTATGTTTTAAATGTGTGTATGG + Intronic
1147494326 17:40901536-40901558 GTATATATTATATATGTGGTGGG + Intergenic
1147720299 17:42535983-42536005 GTATTTATTAGATGGTTGGATGG + Intergenic
1148038138 17:44684282-44684304 GTATATATTATATATATGTAGGG + Intronic
1149043605 17:52219320-52219342 GTAAATGTTAAATGGATGAATGG - Intergenic
1151115934 17:71734974-71734996 ATATATATTTACTGTATGGTAGG + Intergenic
1152051027 17:77977672-77977694 GTAAATATTAAAAGCATGAAAGG - Intergenic
1152482777 17:80566452-80566474 TTATATAAAAAATTTATGGAAGG + Intronic
1153345356 18:4019941-4019963 GTAAATCTTACATGTATTGATGG - Intronic
1154379918 18:13839712-13839734 CTAAATATTAAAAGTATTGAAGG - Intergenic
1155951427 18:31917821-31917843 GTATATATAAAATGTGTATAGGG + Intronic
1157321899 18:46641124-46641146 GTATTGATTAAGTGTAGGGAAGG - Intronic
1158154026 18:54405163-54405185 GAATATATTAAACCTATGAAAGG - Intergenic
1158268853 18:55690377-55690399 AGATATATTAGATGGATGGATGG - Intergenic
1158921883 18:62201539-62201561 GTATATATTAAATGTAATTATGG + Intronic
1160337805 18:78058351-78058373 TTTTATATTAAAATTATGGAAGG + Intergenic
1160374587 18:78401867-78401889 GTATATATCACATGTACAGAGGG + Intergenic
1163532407 19:17858132-17858154 CTATATATTAATTGTATTGTTGG + Intergenic
1165730962 19:38144353-38144375 GTATATATTGGATGAAAGGATGG + Intronic
1166645707 19:44530242-44530264 GTATTTGTTAAATTAATGGATGG - Intergenic
1167753917 19:51398877-51398899 GTACATATAAAAGGTATAGAGGG - Intergenic
926073666 2:9922798-9922820 GTATTTATTGAATGAATGAATGG + Intronic
926664918 2:15510677-15510699 GTATAGAATGAATGGATGGATGG + Intronic
926872655 2:17440391-17440413 TTACATATTAAACATATGGATGG - Intergenic
928038997 2:27854806-27854828 GTATACATTAAATATATGCAGGG - Intronic
928773224 2:34727159-34727181 GTAAACATTTATTGTATGGATGG + Intergenic
929173137 2:38951138-38951160 GTATAAGTAAAATGTATAGAGGG - Intronic
929212401 2:39371886-39371908 ATATATATTATATGTATAAAGGG - Intronic
929277106 2:40037776-40037798 GTAATTATTAAATGAATGAATGG + Intergenic
930246427 2:48987987-48988009 ATAGAAATTGAATGTATGGAGGG - Intronic
930366281 2:50443810-50443832 GTGTATATTGAAAGTCTGGAAGG - Intronic
930533645 2:52620544-52620566 GTATTTATTTATTGCATGGATGG - Intergenic
930684834 2:54297001-54297023 ATAAATATTGAATGGATGGATGG - Intronic
930919284 2:56731963-56731985 GTATAGCTTAAATTTATGGTTGG - Intergenic
931561230 2:63563479-63563501 ATATATATGAAATGTGTAGATGG + Intronic
931841439 2:66154078-66154100 TGATATATTCAATGTATTGAAGG - Intergenic
931882310 2:66580371-66580393 ATTTATATTAAATATATGCATGG - Intergenic
931977856 2:67663093-67663115 GTATTTATTAAAAATAGGGAAGG - Intergenic
932503538 2:72206086-72206108 GTATATATTAAATGCATTATTGG + Intronic
933152130 2:78928279-78928301 GTATATTTTAAATGGAGGAATGG - Intergenic
933560905 2:83884980-83885002 GTATATACTAGATGTATTTAAGG - Intergenic
933824743 2:86149104-86149126 GTTTATTTTAAATGTAAGGTGGG - Intronic
934522437 2:95027631-95027653 GTATATATTTGATGTGTGGAAGG + Intronic
936581840 2:113707064-113707086 TTAAATATTAAATAGATGGAGGG + Intronic
937494731 2:122406001-122406023 GTATATATTAGATCTCTGAAGGG - Intergenic
937512280 2:122609590-122609612 ATATTTATTAAATGTAGGAATGG + Intergenic
937629955 2:124090076-124090098 ATATTGAGTAAATGTATGGATGG + Intronic
937827436 2:126381999-126382021 ATATATATTTAATGTATATAAGG - Intergenic
939240809 2:139557629-139557651 GTATATATTCAAAGTAGTGAAGG - Intergenic
939786199 2:146516258-146516280 CTATATATTAGATGTATGTTAGG - Intergenic
941420632 2:165279570-165279592 TTATATATAAAATAGATGGATGG + Intronic
941947320 2:171114054-171114076 ATATATTTTAGATTTATGGAAGG - Intronic
942079635 2:172387855-172387877 GTAGGTAATAAATGGATGGATGG - Intergenic
942933085 2:181519923-181519945 GTCTGTATTAAATGTAAAGAAGG - Intronic
943448297 2:188017598-188017620 ATATATCTTAAATGTTTGAATGG + Intergenic
943452191 2:188057523-188057545 GTATATATTAAAAGTATTAATGG - Intergenic
943665430 2:190603909-190603931 GAATATGGAAAATGTATGGATGG - Intergenic
943959543 2:194244731-194244753 GTATATATAAAATAAATTGATGG - Intergenic
944372676 2:199004177-199004199 GTATATTTTAGATGTACTGAGGG - Intergenic
944606878 2:201359867-201359889 GTAAATATTCAATCTCTGGATGG - Intergenic
945857759 2:215088973-215088995 ATATTTATTAAATGGAGGGAGGG - Intronic
947044241 2:225961220-225961242 TTATATATTAAATGAATTTAAGG - Intergenic
947154640 2:227149836-227149858 GTACATTTTAATTGGATGGATGG + Intronic
947156728 2:227169911-227169933 GTTTATATTAAATCTATGTCTGG + Intronic
947809627 2:232994841-232994863 GTATGTATTATATTTGTGGATGG - Intronic
1168859125 20:1033019-1033041 GTACATATTAAATATATTGGGGG + Intergenic
1169554029 20:6730894-6730916 GTATATTTTAAATGTGGTGATGG - Intergenic
1169589913 20:7129173-7129195 ATATTTATGAAATATATGGAAGG - Intergenic
1170148096 20:13199405-13199427 GTATTTTTTGAATGCATGGAGGG - Intergenic
1170328772 20:15184835-15184857 ACATATATTAATTGAATGGAAGG - Intronic
1171724690 20:28605344-28605366 TTATATATTAAATGCAAAGAGGG + Intergenic
1171753374 20:29077704-29077726 TTATATATTAAATGCAAAGAGGG - Intergenic
1171788880 20:29499856-29499878 TTATATATTAAATGCAAAGAGGG + Intergenic
1172266301 20:33617583-33617605 AAATAGATTAAATGTATGGAAGG - Intronic
1172395567 20:34601978-34602000 GTGTATGTAAAATGTATGTATGG + Intronic
1172779928 20:37430463-37430485 GAATATTTTAGATGGATGGATGG - Intergenic
1173633429 20:44533530-44533552 GTTTTGATAAAATGTATGGAGGG + Intronic
1173981871 20:47230702-47230724 GTATACTTTAAATGAATGAATGG - Intronic
1174302465 20:49592517-49592539 GTAAATGTTACATGGATGGATGG - Intergenic
1177998780 21:28134593-28134615 GTATATTTTAAATCTCTGCAGGG + Intergenic
1178675604 21:34629100-34629122 GTATACACTGTATGTATGGAAGG + Intergenic
1179193740 21:39145263-39145285 GTATTTATTGAATGAATGTATGG - Intergenic
1180298241 22:10964034-10964056 TTATATATTAAATGCAAAGAGGG + Intergenic
1180410170 22:12599766-12599788 TTATATATTAAATGCAAAGAGGG - Intergenic
1181898512 22:26132272-26132294 ATATATAATAAATGGATGCATGG + Intergenic
1182977776 22:34639686-34639708 GTGTATCCTAAATATATGGAAGG - Intergenic
950261984 3:11549260-11549282 GTATATATTCAAAGTGTGTAAGG + Intronic
952032316 3:29158521-29158543 TCATATTTTAAATGTGTGGAGGG - Intergenic
952208975 3:31210027-31210049 GTATATATAAAATATTAGGATGG + Intergenic
952234015 3:31460561-31460583 ATATATATTAAATGCAGTGAAGG - Intergenic
952569345 3:34695564-34695586 GTATATCTTTATTGTATGGAGGG - Intergenic
952659368 3:35826211-35826233 GTATTTATTATAAGTATGCAAGG - Intergenic
953705955 3:45230388-45230410 ATATTTATAAAATGAATGGAAGG + Intergenic
954526520 3:51276620-51276642 GTATAGTTAAAATGGATGGATGG + Intronic
955505148 3:59625196-59625218 GAATATGTTCAATGCATGGAGGG + Intergenic
955997276 3:64689539-64689561 GGATATGTAAAATGTAAGGATGG + Intergenic
956102272 3:65780916-65780938 GTATTTTTTAAAAGTTTGGATGG + Intronic
956202838 3:66724431-66724453 ATATATATAAAATATATGTACGG - Intergenic
956444814 3:69315466-69315488 ATATATATCAAATTTCTGGATGG - Intronic
957132942 3:76245365-76245387 GTATTCATTGAATGAATGGATGG + Intronic
957424023 3:80012198-80012220 GTCTATATTAAATAAATGAATGG - Intergenic
957929528 3:86860819-86860841 ATATATATTAAATCTATATATGG - Intergenic
959347284 3:105214092-105214114 GTAGATATTAAAACTAAGGAAGG - Intergenic
959934396 3:112014238-112014260 GTATCTGTTGAATGGATGGAAGG + Intergenic
962076970 3:132092133-132092155 GTATATATTTAAGGTGGGGAAGG - Intronic
962333859 3:134507491-134507513 GTATATATTATATGTAACCAAGG - Intronic
962430451 3:135313909-135313931 GCATTTATTGAATGAATGGATGG + Intergenic
962973066 3:140423188-140423210 GTACTTATTAAATGTATGCAAGG + Intronic
964280667 3:155061150-155061172 GTATAAATTAAAAGTATCGCCGG + Intronic
964410942 3:156397414-156397436 GTATATACTAAATGTGCAGACGG - Intronic
964572171 3:158119681-158119703 GTATATATTTTATGTATAAATGG + Intronic
964924840 3:161943093-161943115 GTATACATCAAATGTGTGCAGGG - Intergenic
964982752 3:162706369-162706391 GTATATAATAACCGTATGGTTGG - Intergenic
965700872 3:171458796-171458818 GCATATACTTGATGTATGGAGGG - Intronic
966178308 3:177163664-177163686 ATATATATAAAATATCTGGAAGG + Intronic
966609225 3:181851775-181851797 GAATATATTAAATACATAGAAGG - Intergenic
967626483 3:191691714-191691736 TTATATATAAAATATATTGAGGG - Intergenic
968324645 3:197802785-197802807 GTATTTGTTGAATGAATGGATGG + Intronic
969997429 4:11327224-11327246 GTATATATTGAATGAATGAGTGG + Intergenic
970044275 4:11832575-11832597 CGATTTATTAAATGTATGTATGG + Intergenic
971859432 4:32085848-32085870 GTATATATAAAATGGGTGAAAGG + Intergenic
972850286 4:43040751-43040773 TTATATATTAAAGGAATTGAGGG + Intergenic
972860222 4:43159460-43159482 GATTATATTAAATGTTTAGAAGG - Intergenic
972946003 4:44256464-44256486 ATATATAGTAAATATATGAAAGG + Intronic
973003336 4:44979319-44979341 GTATAAAATAAATGGATAGAAGG + Intergenic
973793244 4:54397249-54397271 GTATTTGTTGAATGAATGGATGG + Intergenic
974150761 4:58005946-58005968 GTACATGTTAAAGGTAAGGAAGG - Intergenic
974232871 4:59139269-59139291 TTATATATTAAATGAAAAGAAGG + Intergenic
974305605 4:60135130-60135152 GTATATATTTAATATATAGTAGG - Intergenic
974449410 4:62033016-62033038 GTACATATTAATTATTTGGAGGG - Intronic
974578958 4:63769498-63769520 ATATATATTAAATATGTGGACGG - Intergenic
974580095 4:63787005-63787027 GGATTTATTATATGAATGGATGG - Intergenic
975265051 4:72353676-72353698 GTGTACATTAAATCTTTGGAAGG - Intronic
975640818 4:76498382-76498404 GAATAGATTAAATGGATGGATGG + Intronic
976772018 4:88663457-88663479 TTATTTATAAAATGAATGGATGG + Intronic
976837156 4:89387870-89387892 GTATATATTTAGTGTCTAGAGGG + Intergenic
977213147 4:94244663-94244685 GTATAGCAAAAATGTATGGATGG + Intronic
977357183 4:95961829-95961851 GTAGAAAGTAAATGTATGTAAGG - Intergenic
979004528 4:115275300-115275322 GTTTATACAAAATGTATGTATGG - Intergenic
979366316 4:119828472-119828494 GTATATATATTATGTGTGGAGGG + Intergenic
979388870 4:120102941-120102963 GTATCTATTAAATTTATTAAAGG + Intergenic
980275383 4:130643900-130643922 TTTTGTATTAAATGTAAGGAAGG + Intergenic
980599373 4:134999749-134999771 GTATATGTTAAATTTAGGCACGG + Intergenic
980976969 4:139620474-139620496 GTATTTGTTAAATGGATGAATGG + Intergenic
981795070 4:148586304-148586326 AAATATATTGAATGTATGCAAGG - Intergenic
982581502 4:157185447-157185469 GTATCTATTGAATGTATATATGG + Intergenic
982915255 4:161201331-161201353 GTATATCTTACACGTATTGATGG - Intergenic
983070514 4:163262597-163262619 ATATTTATTAAATTTATAGAAGG + Intergenic
983213249 4:164979257-164979279 GGATATATTAAAGGCATCGACGG - Intergenic
983278330 4:165646684-165646706 GTATATTTTATAAGTATGTATGG + Intergenic
983475822 4:168210645-168210667 TTATATTTTAAATGTGTGGAGGG + Intergenic
984284612 4:177713438-177713460 ATATTTAATAAATATATGGATGG + Intergenic
984364976 4:178786571-178786593 CTATATCTTAAATATATGAAAGG + Intergenic
987948442 5:24645768-24645790 GTATATAATTTATTTATGGATGG - Intergenic
989318768 5:40110993-40111015 TTATTAATTAAATGTATTGAGGG - Intergenic
990620368 5:57552551-57552573 ATATATAATAAATGTATTCAGGG - Intergenic
990725454 5:58748637-58748659 GTATATATTTCATTTCTGGAAGG - Intronic
991270275 5:64770718-64770740 GTATTGAATAAATGAATGGATGG + Intronic
991464444 5:66895154-66895176 GTAAACAATCAATGTATGGATGG - Intronic
992320388 5:75607866-75607888 GTTTCTATTCAATGTAGGGAGGG + Intergenic
992344605 5:75864348-75864370 CTATTAATTAAATGAATGGATGG - Intergenic
992537968 5:77730727-77730749 GTAAATATTGGATGGATGGATGG - Intronic
993167535 5:84376755-84376777 GTATATATTAAGTGTCTGTTTGG + Intronic
993356457 5:86914716-86914738 GTACATAATAAATGTATTTATGG - Intergenic
993725016 5:91357090-91357112 GTATATTTTAAATTTAGAGATGG + Intergenic
994646797 5:102480050-102480072 ATATAAATCAAATGGATGGATGG + Intronic
994815229 5:104577340-104577362 ATATATGTTATAGGTATGGAGGG + Intergenic
995907137 5:117138618-117138640 GTTTCTATTAAATGTATGTGAGG - Intergenic
996341952 5:122448544-122448566 ATATATATAAAAAATATGGAAGG - Intronic
996377500 5:122828768-122828790 TTATATATGAAATATATTGACGG + Intronic
996986169 5:129567461-129567483 GCATATTTCAAATGAATGGAAGG + Intronic
997140472 5:131374732-131374754 TTATATAGTAAATGTTTGGGGGG + Intronic
999222975 5:149996961-149996983 GTAAATATAAAATGAATGTATGG - Intronic
999895522 5:156029410-156029432 GTATATCTTGAATGAATGAATGG - Intronic
1000466527 5:161585198-161585220 GTATATATAAGATGTATATAGGG - Intronic
1000673102 5:164087001-164087023 GTATATATTGGATGGATAGATGG - Intergenic
1000761547 5:165231444-165231466 GTATTTGTTAAATGAATGAATGG + Intergenic
1002940082 6:1708229-1708251 GTATATCTCAAAGGTAGGGAAGG + Intronic
1003363694 6:5452638-5452660 ATATTTATTGAATGTTTGGATGG + Intronic
1003520587 6:6855441-6855463 ATATATGTTGAATGAATGGATGG - Intergenic
1003844413 6:10157819-10157841 GGATTTATTTAATGGATGGATGG + Intronic
1004084278 6:12429299-12429321 GTATATAATATATGTGTGCATGG + Intergenic
1004426135 6:15508410-15508432 GTAAGTAGTCAATGTATGGAAGG - Exonic
1004701007 6:18079487-18079509 ATATTTAGTAAATGAATGGATGG - Intergenic
1008235761 6:49047127-49047149 GTAGATAATGAATGGATGGATGG + Intergenic
1009382245 6:63046584-63046606 CTATATGTTCAGTGTATGGATGG - Intergenic
1009648156 6:66435919-66435941 AAATACATTAAATGTATGGATGG + Intergenic
1009822111 6:68815723-68815745 GTGTATGTAAAATGTATTGAAGG - Intronic
1009913553 6:69964026-69964048 GTGTACATCAAATGTATGTATGG + Intronic
1009958531 6:70488400-70488422 GTATATTTGAAAAATATGGAAGG + Intronic
1010053312 6:71533889-71533911 TTATATATTTAATCTATAGACGG - Intergenic
1010095420 6:72037559-72037581 GTATATATTAAATATACGTAGGG - Intronic
1010520389 6:76825153-76825175 ATATATACTAATTGTATGTACGG - Intergenic
1011227508 6:85123808-85123830 GTATATATTGAATGAATGAGGGG + Intergenic
1011915446 6:92499979-92500001 GTAAACATTACATGTATGTAGGG + Intergenic
1012353975 6:98290343-98290365 GTATATTTCAAATGTCTAGAAGG + Intergenic
1012530170 6:100226170-100226192 GTAAATATTTATTGTATGAAGGG + Intergenic
1012542858 6:100381950-100381972 ATATATATTAATTTTATGTAAGG + Intergenic
1012716934 6:102686357-102686379 GAATATTTTAAATGTTTGTATGG + Intergenic
1012718935 6:102716257-102716279 ATATATATTGAATGAATGTAAGG + Intergenic
1012749339 6:103138190-103138212 GTAAATATTAATTTTATAGAAGG + Intergenic
1013430888 6:110054051-110054073 GCATATATTAAAGTTATGTAGGG + Intergenic
1014310688 6:119797461-119797483 CTATATATTATATGCATTGATGG - Intergenic
1014361737 6:120485499-120485521 ATATATTTTAAATTTAAGGATGG + Intergenic
1014735117 6:125084824-125084846 ATATCTGTTAAATGGATGGATGG - Exonic
1015504979 6:133975062-133975084 GAATATATTAAATCTGTGGAAGG + Intronic
1015759065 6:136637926-136637948 GTATTTGTTGAATGAATGGATGG - Intronic
1016261531 6:142176404-142176426 GTATTAATGAAATGTAGGGAAGG + Intronic
1016846831 6:148576561-148576583 GTATAGCTTAAATGTATGTATGG - Intergenic
1016944716 6:149519136-149519158 GTATTTATTCAATGGGTGGATGG + Intronic
1017082046 6:150679375-150679397 GTGAATATTAAATGTAAGTAAGG + Intronic
1017581594 6:155870946-155870968 ATAAATATTGAATGTATGAAGGG + Intergenic
1018158830 6:161016871-161016893 GTAAATATTTATTGCATGGATGG + Intronic
1020459372 7:8411633-8411655 GTATTAATTAAATGGATGGATGG - Intergenic
1021230874 7:18085712-18085734 TTATAGATTAATTATATGGATGG - Intergenic
1021275194 7:18641540-18641562 GAATATAGTAAATGTATGAATGG - Intronic
1021972646 7:25980881-25980903 GTGTCTATTGAATGGATGGATGG - Intergenic
1022179544 7:27905287-27905309 TTATATATGACATATATGGAAGG + Intronic
1022766811 7:33422125-33422147 GTAAATATAAATTGTATGTACGG + Intronic
1022826686 7:34021830-34021852 ATAAATATTCAATGGATGGAGGG - Intronic
1022873640 7:34505477-34505499 ATATATATTACATATATAGAAGG - Intergenic
1024122122 7:46254070-46254092 GTATATCTTATGTGTATTGATGG + Intergenic
1024317200 7:48032222-48032244 GTATACTTGAAATGTATTGAGGG + Intergenic
1024701955 7:51913339-51913361 ATATATTTTAAATAAATGGATGG - Intergenic
1025924700 7:65947982-65948004 GTATTTTTTAAATGTAGGGCCGG - Intronic
1026298033 7:69073008-69073030 GTGTATATTAAATGTATGGAGGG - Intergenic
1026934807 7:74248097-74248119 GTATATTTAAAGTGTATGGAAGG - Intronic
1027852481 7:83465876-83465898 GTAAATATTATATGTGTGGCAGG + Intronic
1028696718 7:93722303-93722325 ATATATATTATATTTGTGGAAGG + Intronic
1028760856 7:94494636-94494658 GTATATATTCAAAATATGTAGGG - Intergenic
1029804736 7:102984378-102984400 ATATATATCTAATGGATGGATGG - Intronic
1030339360 7:108359173-108359195 GCATTGATTAAATGGATGGATGG - Intronic
1030645932 7:112061540-112061562 TTCCATATTAAATGTAAGGATGG - Intronic
1030675075 7:112375861-112375883 GTAGATGTTAACTGGATGGATGG - Intergenic
1030836068 7:114287393-114287415 AAATATGTTAAATGTATTGAAGG - Intronic
1030946165 7:115723667-115723689 GTATATAATAGATGTATTAATGG + Intergenic
1031027955 7:116701640-116701662 ACATATATTAAATGTATGTAGGG - Intronic
1031631988 7:124054245-124054267 CTAAATATTAAATGTATAAACGG + Intergenic
1031680442 7:124666860-124666882 GTGTATGTTAAATGTTTAGATGG - Intergenic
1032577916 7:133075283-133075305 GTATATACTAAACCTATTGAAGG + Intronic
1032910879 7:136428203-136428225 GAATATATTACATGTACAGAAGG + Intergenic
1033811991 7:145025357-145025379 GTATATATCAATTTTATGTATGG + Intergenic
1037209619 8:16370854-16370876 GTATACCTTACATGTATCGATGG - Intronic
1037568635 8:20140008-20140030 GTATACTTTAAATGGATGAACGG + Intergenic
1037614497 8:20506444-20506466 ATAAATATTAAATGCATGAATGG + Intergenic
1037897122 8:22665336-22665358 GTGTTTATTAAATATATGAATGG - Intronic
1040660384 8:49567924-49567946 GTATATATTTAAGGTGGGGAAGG + Intergenic
1041136886 8:54768497-54768519 GTATGTATTGAATGGATAGATGG + Intergenic
1041347547 8:56915920-56915942 TTATATATAAAAGGTATGCAGGG - Intergenic
1042043903 8:64625892-64625914 TTATATAATAAAGGTATAGAGGG + Intronic
1042877825 8:73455894-73455916 GTACATATGAGATGGATGGACGG + Intronic
1043115225 8:76243427-76243449 ATATATATTATATATATGGTAGG + Intergenic
1043170819 8:76964288-76964310 GTATATGTTAAAGGTATTTATGG - Intergenic
1043513451 8:80973655-80973677 GTTTAAATAAAATGTATGAAAGG - Exonic
1043654467 8:82645246-82645268 GTGTTTAATAAAAGTATGGAAGG - Intergenic
1044406644 8:91834695-91834717 GTATATATATAATGTATATATGG - Intergenic
1045001368 8:97881100-97881122 ATATTTATTAAGTGTCTGGATGG - Intronic
1045184134 8:99818902-99818924 GAAAATGTAAAATGTATGGAAGG - Intronic
1045639192 8:104228630-104228652 GTATAAATATAATGGATGGATGG - Intronic
1045644218 8:104284358-104284380 GTATATCTTACATGTATTGATGG - Intergenic
1045912048 8:107422049-107422071 GTAAATTTTAGAGGTATGGATGG - Intronic
1046255234 8:111688150-111688172 TTATATATTATATATATGAATGG + Intergenic
1046388483 8:113536115-113536137 GTGTATAGAAAATGCATGGAAGG - Intergenic
1046576749 8:116039474-116039496 GTATACATTGAATGAATGAAAGG - Intergenic
1047552535 8:125891033-125891055 ATATATATAAAATCTATTGATGG + Intergenic
1048180658 8:132191526-132191548 ATATATATATAATATATGGATGG + Intronic
1048229412 8:132622221-132622243 GTATAAAGTAGATGTATAGAAGG + Intronic
1048258808 8:132927282-132927304 CTGTATATTGAATGGATGGAGGG - Intronic
1048989389 8:139752417-139752439 GTAGATGTTAGATGGATGGATGG - Intronic
1049129995 8:140830353-140830375 ATATATTTTACATGTAAGGAAGG + Intronic
1051138550 9:13952093-13952115 GTTTATATTAAATGGACGGTTGG + Intergenic
1051800292 9:20925061-20925083 ATATATATTACATGTAGGGAAGG + Intronic
1052150583 9:25110054-25110076 ATATGTATTAATTGTATGAAAGG - Intergenic
1052347036 9:27420473-27420495 ATATATATGAAATATATAGATGG - Intronic
1052432490 9:28385013-28385035 GTAAATATTAATTGAATGAAAGG - Intronic
1052845767 9:33334997-33335019 GCATAAATAAAATGTAGGGAAGG - Intronic
1054848567 9:69822293-69822315 GCATATATTACATGAATGAATGG - Intronic
1055703001 9:78966791-78966813 GTTTATAATATTTGTATGGAGGG - Intergenic
1056053107 9:82790892-82790914 GTATATTTTATATGTAATGATGG + Intergenic
1056402752 9:86243942-86243964 GTATATATAAGGTGAATGGATGG - Intronic
1057032947 9:91791818-91791840 TTATGTATTAAATGTATTAAAGG - Intronic
1057032948 9:91791841-91791863 TTATGTATTAAATGTATTAAAGG - Intronic
1057348335 9:94272676-94272698 GTATCCATTCAATGTATGAACGG - Intronic
1057374961 9:94513034-94513056 GTATTTATTGAATGAATGAATGG - Intergenic
1057579999 9:96279291-96279313 GTACATCTTACATGTATTGATGG - Intronic
1057966300 9:99506690-99506712 GTATATATAAAATATATGTGTGG + Intergenic
1060609872 9:124953754-124953776 GGAAATTTTAAATGTATGGCAGG - Intronic
1061552658 9:131346887-131346909 ATATTTATAAAATGGATGGATGG + Intergenic
1203449894 Un_GL000219v1:102158-102180 TTATATATTAAATGCAAAGAGGG + Intergenic
1186123758 X:6390386-6390408 ATATTTATTAAATCAATGGAAGG + Intergenic
1186165131 X:6819958-6819980 ATATATATTTTATGTCTGGATGG - Intergenic
1187024134 X:15416195-15416217 GTATATATTCTAAGTATGAAGGG + Intronic
1187118398 X:16378508-16378530 GAATGTATGGAATGTATGGAAGG - Intergenic
1188388330 X:29589702-29589724 ATATATATTAAATGTCTAGTAGG + Intronic
1188704256 X:33306482-33306504 GTATTTGCTAAATGTATAGAGGG + Intronic
1188985864 X:36767874-36767896 ATAAAAATGAAATGTATGGAAGG - Intergenic
1189349998 X:40268975-40268997 GAATATATTACATGTGTGGTGGG - Intergenic
1189502531 X:41576656-41576678 GAATATATAAAATGAATGAATGG + Intronic
1193093837 X:77525891-77525913 TTATATATTTAATGGTTGGAGGG + Intronic
1193292044 X:79786246-79786268 GAATACATTAAATGTGTGGGAGG - Intergenic
1193426748 X:81348926-81348948 TTATATATTTTTTGTATGGATGG + Intergenic
1193906484 X:87251913-87251935 CTATATAAAAAATATATGGAGGG + Intergenic
1194000212 X:88419340-88419362 GTAAATATTAAATGCAGGAAGGG - Intergenic
1195095615 X:101498469-101498491 GGATATATTAAATATAAGGAAGG + Intronic
1195169015 X:102247596-102247618 GTTTATATAAAATTTATAGAAGG - Intergenic
1195189842 X:102439493-102439515 GTTTATATAAAATTTATAGAAGG + Intronic
1196040835 X:111201846-111201868 ATATATATGAAATGTATATATGG + Intronic
1196232890 X:113245127-113245149 GTACATAATAACTGTATGTATGG + Intergenic
1197881434 X:131170803-131170825 CTATATATTAAATGTATTTGTGG - Intergenic
1199111971 X:143946100-143946122 ATATTTCTTAAATGTATGTACGG + Intergenic
1199272538 X:145901028-145901050 TCATATATTATATATATGGAAGG + Intergenic
1199462071 X:148095895-148095917 GTATGTGTTAAATGCATGGATGG - Intergenic
1199521768 X:148743948-148743970 GTGTATATGAAATATATAGAAGG + Intronic
1200270255 X:154676017-154676039 CTCTACATTAAAGGTATGGAAGG - Intronic
1200385098 X:155882195-155882217 ATATTTGTTAAATGTATGAATGG - Intronic
1201405061 Y:13641727-13641749 ATATTTATTAAATGTTTTGAAGG + Intergenic
1201676184 Y:16587246-16587268 GTATATAGTGAATTTAAGGAGGG - Intergenic
1201917359 Y:19196575-19196597 ATATATAATGAATGAATGGATGG + Intergenic