ID: 1099214168

View in Genome Browser
Species Human (GRCh38)
Location 12:79834020-79834042
Sequence CTCAGTATATATTAAATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099214168_1099214169 -4 Left 1099214168 12:79834020-79834042 CCATACATTTAATATATACTGAG 0: 1
1: 0
2: 2
3: 40
4: 351
Right 1099214169 12:79834039-79834061 TGAGCACCTACTATTTTGCCAGG 0: 1
1: 3
2: 9
3: 57
4: 378
1099214168_1099214172 17 Left 1099214168 12:79834020-79834042 CCATACATTTAATATATACTGAG 0: 1
1: 0
2: 2
3: 40
4: 351
Right 1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG 0: 1
1: 0
2: 1
3: 11
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099214168 Original CRISPR CTCAGTATATATTAAATGTA TGG (reversed) Intronic
901184602 1:7364846-7364868 CTCAGTATATACTGAGTGAATGG + Intronic
904067955 1:27769724-27769746 CTCAATAAAAATTAAATGTAAGG + Intergenic
906555613 1:46710265-46710287 ATCACTATACATTACATGTATGG - Intronic
906832873 1:49052056-49052078 CAGAGTTTATATTATATGTAGGG + Intronic
908428862 1:64036267-64036289 CTCAGTTTATATTTACTGGATGG - Intronic
908644098 1:66258400-66258422 CTCCGTATCTATAAAATGAAGGG + Intronic
909183821 1:72459716-72459738 TTCAGTATAAATTAGATGAATGG + Intergenic
909564779 1:77042227-77042249 CTCAGTAAATATTAACTGACTGG + Intronic
910353550 1:86328266-86328288 ATCACTATATATTATATGTATGG - Intergenic
911310130 1:96282089-96282111 TCCAGTACATATTAAGTGTAAGG - Intergenic
912909194 1:113740077-113740099 CTCAGTATATATCCAAAGGAAGG - Intronic
912986913 1:114442932-114442954 CTAAATTTATATTAAAAGTAGGG - Intronic
914986258 1:152459757-152459779 CTGAGTATATATTATATGCTGGG + Intergenic
915397109 1:155593612-155593634 CTGAGTATCTATTAGATGTTAGG - Intergenic
915412557 1:155713855-155713877 CTGAGTATCTATTAGATGTTAGG - Intronic
915615040 1:157031172-157031194 CTGAATACATATTAAATGTTAGG - Intronic
916301139 1:163275780-163275802 CTCAGGATATATAATAAGTAAGG + Intronic
916414426 1:164579234-164579256 TTGAATATATAATAAATGTAGGG - Intronic
916890172 1:169106289-169106311 CGCGGTATATAGTAAAGGTAGGG + Intronic
917525161 1:175781938-175781960 CTCAATAAATATTAACTGAATGG + Intergenic
917881314 1:179339151-179339173 CTTAATATATATTAAATTTAGGG + Intronic
918016958 1:180644547-180644569 CTCATTATTTATTAGATGTAAGG + Intronic
919368497 1:196696361-196696383 CTGAGTAAATATTGAAAGTAAGG + Intronic
919592482 1:199521781-199521803 CTCAGTATCTATTGGATGAACGG + Intergenic
921080429 1:211734997-211735019 CTCAGTACATATTGACTGAAAGG + Intergenic
921650578 1:217673684-217673706 CTCACTATATAGAAAATGGAGGG - Intronic
921769108 1:219013670-219013692 ACCAGCATATATGAAATGTAGGG + Intergenic
921883816 1:220283557-220283579 ATCAGTATAAATTTTATGTATGG + Intergenic
922632248 1:227127794-227127816 CTTTGTTTATATTAAATATATGG - Intronic
923620671 1:235576744-235576766 CTCGATAAATATTAAATGAATGG + Intronic
923918719 1:238540028-238540050 CTAGGTAGATAATAAATGTAAGG + Intergenic
924132337 1:240924402-240924424 CTCAGTAAATGTTCAATGGAAGG - Intronic
924458372 1:244236542-244236564 CTCAGTAAATACTGAATGAATGG - Intergenic
1062933122 10:1365473-1365495 CTCACTTTAAATCAAATGTAGGG + Intronic
1063515647 10:6692409-6692431 ATCAATTTATAGTAAATGTAGGG - Intergenic
1066230823 10:33431325-33431347 CTGAGAATTTATTAAATGCATGG + Intergenic
1066476736 10:35754269-35754291 ATCTGTATACATTAGATGTATGG + Intergenic
1066590179 10:36986131-36986153 CTCAGTATATACTAGGTGTTTGG + Intergenic
1067928685 10:50537947-50537969 CCCATTACATATTAAATGTTTGG + Intronic
1068499780 10:57829897-57829919 CTCATTATAAAGTAATTGTAAGG - Intergenic
1068773488 10:60847962-60847984 GTGTGTATATATTAGATGTATGG + Intergenic
1068775056 10:60860006-60860028 CACAGTATGTTTTAAATGTATGG - Intergenic
1070567438 10:77614634-77614656 CTCAGTTTCCATTACATGTAGGG - Intronic
1070684353 10:78469855-78469877 TACAGTATATATTTAATTTACGG - Intergenic
1071013393 10:80965856-80965878 CACAGTATATATTCTAAGTAGGG - Intergenic
1071692518 10:87837221-87837243 CTTATAATATATTAAATGTCTGG - Intronic
1074119392 10:110482217-110482239 CTCAATAAATATTCAATGGATGG + Intergenic
1074712364 10:116188064-116188086 CCCAGTATGTATTATATATAGGG - Intronic
1075560508 10:123464800-123464822 CTTAGTACATATCAAATTTAGGG + Intergenic
1077835328 11:5922289-5922311 TTCAGTAGATTTTTAATGTAAGG - Intronic
1077860267 11:6171745-6171767 GTCAGTATATTTTAAATATTTGG + Intergenic
1078027998 11:7717308-7717330 CTGAAAATTTATTAAATGTATGG + Intergenic
1079044570 11:17089466-17089488 ATTAGTATATATTAAGTTTAGGG + Exonic
1079853515 11:25569550-25569572 CTCAATAAATATCAAATGAATGG - Intergenic
1080448165 11:32356271-32356293 CTCAGGATATTTTAGATATAGGG + Intergenic
1080483267 11:32675263-32675285 CTCAATAAATATTGAATGAATGG + Intronic
1080941921 11:36928096-36928118 CTCAGTAAATATTAGCTGTTTGG + Intergenic
1081106036 11:39070925-39070947 TTCAATAGTTATTAAATGTATGG + Intergenic
1081632375 11:44698604-44698626 TTCAGTATATATTCAAAGTGTGG + Intergenic
1084713247 11:70857325-70857347 CCCAGTAAATACTCAATGTACGG + Intronic
1085040720 11:73324834-73324856 CTCAGTAAATATTAGTTGAATGG + Intronic
1085763969 11:79266200-79266222 CTCAGTAAATGTTAGATGAATGG + Intronic
1085992292 11:81863823-81863845 CTCAGTAAAGATTCAATTTAAGG - Intergenic
1086219330 11:84422663-84422685 CTTAGTATATATTAATTTGAGGG - Intronic
1086265629 11:84994354-84994376 ATGGCTATATATTAAATGTAAGG + Intronic
1086271821 11:85076835-85076857 CTCAGCAGATATTAAATGGAAGG - Intronic
1087945108 11:104149930-104149952 CACAGTATATATTAAGTGATGGG - Intronic
1089019919 11:115202825-115202847 GCCAATATATATTAAATATATGG + Intronic
1089205595 11:116759389-116759411 CTAACAATATATTAAATGGAGGG + Intronic
1089592168 11:119549326-119549348 CTCAGGATATTTTATAGGTAAGG + Intergenic
1090584762 11:128199297-128199319 CTCAGTGTTTATTATATGTCAGG + Intergenic
1091113726 11:132994670-132994692 TTCAGTTTAAATTAAATGTGCGG + Intronic
1092142423 12:6193085-6193107 CACAATATTTATTGAATGTATGG - Intergenic
1093962900 12:25294641-25294663 CTCAGTATAATTGTAATGTAAGG + Intergenic
1094019714 12:25901328-25901350 CTTAGTATCTCCTAAATGTAAGG - Intergenic
1095621222 12:44256854-44256876 CTCAGTATATAATGATTGTTTGG + Intronic
1097553453 12:61105569-61105591 ATTAGTGTATATTAAATGTTTGG + Intergenic
1097733746 12:63158270-63158292 CTCTGAATATATTTAAAGTATGG + Intergenic
1097799662 12:63899864-63899886 CTCCTTATATAATAAATGTAAGG + Intronic
1097991786 12:65843045-65843067 CTCAGAATATTTTAAAAGAAAGG + Intronic
1098030887 12:66252553-66252575 CTAAGTATTTATTCAATGAATGG - Exonic
1098705350 12:73681418-73681440 CTCACTATATTTTTAATTTATGG + Intergenic
1098719663 12:73880854-73880876 CACAGGTTATGTTAAATGTAGGG + Intergenic
1098722679 12:73922686-73922708 CTCAGCATTTTTCAAATGTATGG + Intergenic
1099214168 12:79834020-79834042 CTCAGTATATATTAAATGTATGG - Intronic
1099390749 12:82075833-82075855 ATCAATATACATTATATGTATGG - Intergenic
1099684935 12:85872892-85872914 CTAAGTAATTATTAAATGTTTGG + Intergenic
1099983434 12:89634049-89634071 CTAAGTAAATATGAAATGGAAGG - Intronic
1100118833 12:91344412-91344434 CTCAGTCTTTATGAAATGCAAGG - Intergenic
1100666017 12:96754433-96754455 CTGAGTATCTATTAAATGCTAGG + Intronic
1101476813 12:105058525-105058547 CTGAGTATATATGAAAGGAAAGG - Intronic
1101483117 12:105121890-105121912 CTGAGTACTTATTAAATGTCTGG + Intronic
1102927684 12:116839282-116839304 CTCAGTAAATATTGGATGGATGG + Intronic
1106464790 13:30003584-30003606 CTCTCTATATATTAGATGGATGG - Intergenic
1106862249 13:33922379-33922401 CTCAGGAAATATTCAATTTAAGG + Intronic
1106975850 13:35213348-35213370 CTCAATATTTATTAAACCTAAGG - Intronic
1107212933 13:37879423-37879445 CTCAGTAAATATCAAATGGATGG - Intergenic
1107358615 13:39595220-39595242 CTCAGGATTTATTAAAAGCAAGG - Intronic
1107730734 13:43345866-43345888 CTCAGTATTTTTTAAATGAATGG - Intronic
1107889198 13:44899372-44899394 CTCCGTAGATATTAAATTTGTGG - Intergenic
1108092751 13:46866580-46866602 CTCAATATTTGTTAAATGAATGG - Intronic
1108387223 13:49911051-49911073 ATCATTATATATTTAAGGTATGG + Intergenic
1108537885 13:51404895-51404917 CTCAGGATTTATTTAATGAAAGG + Intronic
1108866567 13:54931031-54931053 CCCAGGATATATTAAAGTTAAGG - Intergenic
1109310548 13:60687514-60687536 ATCACTATACATTATATGTATGG - Intergenic
1109953762 13:69537627-69537649 CTCAGTTTACATTAAATATACGG + Intergenic
1110981018 13:81898415-81898437 CTCAGAATCTATTAAATAAATGG + Intergenic
1111080504 13:83300790-83300812 CTAAGTATAAATTATATGAAAGG - Intergenic
1111486733 13:88911413-88911435 CTCAGGATATATTTTGTGTAAGG - Intergenic
1111571590 13:90094566-90094588 CTTGGAATTTATTAAATGTAAGG - Intergenic
1111832827 13:93351658-93351680 ATGACTATATATTATATGTATGG + Intronic
1117118499 14:52541759-52541781 CTAAGTTTAAATTAAATGAAAGG + Intronic
1117671988 14:58117626-58117648 CTCAGTATATGTTTATTGAATGG + Intronic
1118302374 14:64627043-64627065 CTCAGTAAATGTTAAATGGATGG - Intergenic
1118345328 14:64936272-64936294 CATAGTAAATATTAAATGAATGG + Intronic
1118405602 14:65420843-65420865 CACAGTATATAATACATATAAGG - Intronic
1119134058 14:72200708-72200730 CACAGTATTTGTTAAATGTCTGG + Intronic
1119827089 14:77666155-77666177 CTCAGTATATGTTGAATGAATGG - Intergenic
1121247692 14:92474279-92474301 CTCAACACATATTAAATGTATGG - Intronic
1122567359 14:102669903-102669925 CTCAGGATATATTGAAAGTATGG + Intronic
1123196321 14:106619822-106619844 CTGAGGAAATAGTAAATGTAAGG + Intergenic
1124049443 15:26182116-26182138 CTCAGTATATATAAAAAATGGGG + Intergenic
1125427271 15:39561829-39561851 CTTAGTATTTATTGAATATATGG - Intergenic
1125431865 15:39603462-39603484 CTCAGTATAGCTTAAATGCCAGG + Intronic
1125544547 15:40493032-40493054 CTGAGCATATATTAAAGGGAAGG - Intergenic
1126327476 15:47496468-47496490 AGGAGTATGTATTAAATGTAGGG - Intronic
1127582479 15:60350289-60350311 CTCAGTATATATTTATTGAATGG - Intronic
1127634233 15:60853921-60853943 CCCAGTAAAGATTAAATGTGAGG + Intronic
1128494571 15:68187441-68187463 CTCAGGCTATCTTAAATTTAGGG + Intronic
1131589617 15:93734342-93734364 CTCAATACATATTGAATGTCAGG + Intergenic
1133628798 16:7598765-7598787 ATCTGTATATATTAAATTAAAGG - Intronic
1135608890 16:23847600-23847622 ATAAATATATATTAAATGAATGG - Intronic
1135866758 16:26110258-26110280 ATCTGTATATATTATATATATGG + Intronic
1137459123 16:48642426-48642448 ATCACTATATATTACATGTATGG - Intergenic
1139172202 16:64645822-64645844 TTGAGCATCTATTAAATGTATGG + Intergenic
1140197729 16:72869186-72869208 CCCAGTATTTTTTAAATGTAAGG - Intronic
1140609885 16:76585415-76585437 CTCAGTTTATGTTATCTGTAAGG - Intronic
1140946301 16:79771073-79771095 CACACTATATATTAAAAGTGAGG - Intergenic
1142838900 17:2611590-2611612 TTCAGCATAGATTAAATGTAAGG + Intronic
1146119483 17:30178953-30178975 GTAAGTTTATATTGAATGTAGGG + Intronic
1147853632 17:43461494-43461516 CTCAGTGTTTGTTGAATGTATGG + Intergenic
1149788954 17:59460656-59460678 TTCAGTATATATTAGCTGAATGG - Intergenic
1149818288 17:59748602-59748624 CTCAGTACCTAGTAAATGCAAGG + Intronic
1149890300 17:60383416-60383438 CTCAGTAAATATTGGATGTCTGG - Intronic
1150661023 17:67079038-67079060 CTCAGTATATAATACAAGGAAGG - Intronic
1151855311 17:76717101-76717123 CTCAGTCTTTCTTAAATGCATGG - Intronic
1152220977 17:79066016-79066038 CACAGTATATATCATATATATGG - Intergenic
1155459154 18:26056990-26057012 CTCAGTGTATAAATAATGTAAGG + Intronic
1155556607 18:27026633-27026655 GTCAGTCTATATTGATTGTATGG - Intronic
1155647688 18:28100021-28100043 CTCAGTAAATATTGGATGGATGG - Intronic
1156542845 18:37932758-37932780 CTGAGAAAATATTAATTGTAAGG + Intergenic
1157037630 18:43994835-43994857 CTCAGTAAATACAAAATGTGTGG - Intergenic
1157628637 18:49074180-49074202 CTCAGAATATTTTAAATCCATGG - Intronic
1157869878 18:51220220-51220242 CTCAATAAATATTAAATCAAAGG - Intergenic
1158541860 18:58364203-58364225 CTCAGTATACATAAAATTTCAGG + Intronic
1159141285 18:64398367-64398389 CTCAGTATTTATTGAATACATGG - Intergenic
1159565445 18:70042777-70042799 CTAACTATAAATTATATGTAAGG + Intronic
1160269990 18:77374884-77374906 TTCAAAATATCTTAAATGTAAGG - Intergenic
1160344467 18:78121518-78121540 CTCAGAATATATTTAAACTAGGG + Intergenic
1162395462 19:10416074-10416096 CTCAGTAAATATTTAATAAATGG - Intronic
1162752964 19:12840210-12840232 CTCAGTATGGATTATGTGTAGGG - Intronic
926692441 2:15746742-15746764 CTGAGTATATCTTACATGTCGGG - Intergenic
930190629 2:48455510-48455532 ATTAATATATATTAAATGTTAGG + Intronic
930331922 2:49995973-49995995 CTCAGTAAATATTCATTGAAAGG - Intronic
930348946 2:50224560-50224582 ATTAATATATATTAAATGTTTGG - Intronic
930409848 2:51011554-51011576 CTCAGTAGAGATTCAATGGAAGG + Intronic
930430383 2:51267992-51268014 CTCCGTATATATTAAAAGCCTGG + Intergenic
930684835 2:54297005-54297027 CTCAATAAATATTGAATGGATGG - Intronic
932041374 2:68303317-68303339 CTCAGGATATTTTAAGTGAAAGG - Intronic
933570920 2:84010863-84010885 ATCACTATACATTATATGTATGG + Intergenic
933824746 2:86149108-86149130 CCCTGTTTATTTTAAATGTAAGG - Intronic
935873606 2:107480668-107480690 CTCTGTATCTATGAAATGAATGG - Intergenic
937383424 2:121403339-121403361 CTCAGTAAATGTTAAATGACTGG + Intronic
937930164 2:127198541-127198563 ATGATTGTATATTAAATGTAAGG - Intronic
938600356 2:132831609-132831631 CTCTTTATATATTAATAGTATGG + Intronic
938609326 2:132930839-132930861 CACAGCATGTACTAAATGTAGGG + Intronic
938612829 2:132966684-132966706 AACAGTATATGTTAAATGTAAGG - Intronic
939228513 2:139395218-139395240 ATAAAAATATATTAAATGTAGGG + Intergenic
940235596 2:151507982-151508004 GTAAGTTTTTATTAAATGTAAGG - Intronic
940526308 2:154819178-154819200 CTCAGCATATAGTGAATGAAAGG + Intronic
940623977 2:156149675-156149697 CTCAGCTAATAATAAATGTAAGG + Intergenic
941852870 2:170201603-170201625 CTCAGAATATATAAGATGTAAGG + Intronic
942482157 2:176400665-176400687 TTCAGTATATATAATATGTTGGG + Intergenic
942642418 2:178073290-178073312 CTCAGTAAATATTAATGGAATGG + Intronic
943036521 2:182753085-182753107 TTCAGTATATTTAAAATATAAGG - Intronic
943437909 2:187890309-187890331 CTCAGTGTAAAATAAATCTAAGG - Intergenic
945112224 2:206370855-206370877 CTCAGTGTATATTCATTGAATGG - Intergenic
945695866 2:213104061-213104083 TGCAGTATACATAAAATGTAAGG + Intronic
945991770 2:216401947-216401969 TTTTGTATATATTAAATATATGG + Intergenic
946560701 2:220909317-220909339 CTCACTATACATTATATGAATGG + Intergenic
947099364 2:226603270-226603292 ACCAGTATATATTTAATGTACGG + Intergenic
947154639 2:227149832-227149854 CTCAGTACATTTTAATTGGATGG + Intronic
1169848408 20:10022177-10022199 CTGAGTATATATTAAAGTTAGGG - Intronic
1169971008 20:11269551-11269573 CTTAGTAAATATTTAATGTATGG - Intergenic
1169992946 20:11523778-11523800 CTCAGTAAACATTTAATGAATGG - Intergenic
1171112490 20:22496822-22496844 CTCAGCAAATAGTTAATGTAAGG + Intergenic
1172496830 20:35392662-35392684 CTAAGTATATGTTGAATGAATGG - Intronic
1173050744 20:39558787-39558809 CTCAGAATATAGTATAGGTAAGG + Intergenic
1173458436 20:43222546-43222568 CTGAGTACTTATTAAATGTTAGG + Intergenic
1174028159 20:47597070-47597092 CTCATTAAATTGTAAATGTAAGG - Intronic
1177015242 21:15779576-15779598 CTAATTATATAATAAAAGTAAGG + Intronic
1177439499 21:21102410-21102432 CTCAGGTTATATTTAATATATGG + Intronic
1178408072 21:32341192-32341214 GTCAGCATGTATTAAATGTGGGG + Intronic
1181894003 22:26090398-26090420 CTGAGTATATATTACATATAAGG - Intergenic
1182016618 22:27045741-27045763 CTCCGTATTGATTAAATGTCTGG - Intergenic
1183141061 22:35939544-35939566 CTAAGTAAATATTAAATATTAGG - Intronic
1183837230 22:40464846-40464868 CCCAGTATTTTTTAAATGTCTGG + Intronic
949711632 3:6877107-6877129 CTCAATATATTTTGAATGAATGG - Intronic
951227669 3:20140166-20140188 CTCAGTAGATATTTGGTGTATGG + Intronic
951366539 3:21790020-21790042 TTCAGTAACTATTAAATGAAAGG + Intronic
951552964 3:23894080-23894102 CTAAGTGTCTGTTAAATGTATGG + Intronic
952068294 3:29599726-29599748 CTTCGTATATATTCAATATAGGG + Intronic
952994352 3:38864021-38864043 CTCAGTTTTTAGTAAATGTAAGG + Intronic
953010739 3:39023083-39023105 GTCAGTATCTCTAAAATGTAAGG - Intergenic
954378587 3:50207621-50207643 CTCAGCAAATGTTAAATGAATGG - Intronic
955057023 3:55463870-55463892 CTCAATAAATATTTAATGAATGG - Intergenic
955188780 3:56740691-56740713 TTCACTATATATTAAAAATATGG - Intronic
956037939 3:65116019-65116041 TTCAGTATATATGAAAGTTAAGG - Intergenic
956148607 3:66217848-66217870 CTTAGTATATATAAACTATAAGG - Intronic
957275926 3:78091865-78091887 CTCACCACATATAAAATGTAAGG - Intergenic
957453212 3:80406497-80406519 CTCAGTAAATATTAGACATAAGG + Intergenic
957748636 3:84379326-84379348 AACAATAAATATTAAATGTAGGG + Intergenic
958777418 3:98502917-98502939 CTCAGGGTCTATTAAATGCATGG + Intronic
963169565 3:142237125-142237147 CTAAGTATATTTTTAAAGTAGGG - Intergenic
964358174 3:155869592-155869614 CTCAGTATATATAGAATGTAAGG - Intergenic
964774469 3:160260457-160260479 TTCAGTATATTATCAATGTATGG - Intronic
964889933 3:161522193-161522215 CTCAATAAATATTTAATATATGG - Intergenic
965005299 3:163014685-163014707 GTCAGTATATAAAAAATGCATGG + Intergenic
965111358 3:164427952-164427974 GTCACGATAAATTAAATGTAAGG - Intergenic
966267907 3:178068843-178068865 CTCAGGTTATATAAAATTTAGGG + Intergenic
966574608 3:181485960-181485982 CTCTGGAAATAATAAATGTAAGG - Intergenic
966655673 3:182355710-182355732 CTCAATATATTTTGAATGAATGG - Intergenic
967354155 3:188549085-188549107 ATCAATATACATTATATGTATGG + Intronic
967400842 3:189058849-189058871 CTCAAAATATATTAACTATAAGG + Intronic
967673978 3:192273653-192273675 CTCAGTAAATATTAAATGAATGG + Intronic
967976611 3:195038896-195038918 GTCAGCATATAATAAAGGTAGGG + Intergenic
970039879 4:11784185-11784207 CTCAGTATATATTAGAAATTTGG + Intergenic
971212340 4:24630885-24630907 TTCAATATATATATAATGTATGG - Intergenic
971602021 4:28605050-28605072 TTCAATATCTATTAAATATATGG + Intergenic
971847471 4:31938596-31938618 CTCAGAATTTTTTAATTGTAAGG + Intergenic
972889874 4:43543929-43543951 CTAAATAAATATTAAATGAATGG + Intergenic
973835690 4:54807048-54807070 CTCAATATATATAAAAGTTATGG + Intergenic
976614613 4:87063753-87063775 CTCACAATATACTAAATGTCAGG - Intronic
977813241 4:101383437-101383459 CACAGGATTTTTTAAATGTAAGG - Intergenic
978239576 4:106499484-106499506 CTGAGTATATTTTAAAATTAGGG - Intergenic
978676218 4:111320483-111320505 GACAGTAAATATTAAATCTAGGG + Intergenic
979119395 4:116876940-116876962 CTCTAAATTTATTAAATGTAGGG + Intergenic
979731865 4:124033050-124033072 CTCAGAATATATTTATTATAAGG + Intergenic
980009212 4:127577816-127577838 CACAATAAATATTAAAGGTATGG - Intergenic
980059766 4:128116598-128116620 GCCAGTATATCTGAAATGTATGG + Intronic
980113178 4:128654082-128654104 CTCAGTAAATATTAATTGAAGGG + Intergenic
980176759 4:129355261-129355283 CTCATTATGTACTAAATGAAGGG - Intergenic
980484729 4:133440851-133440873 TGCAGTATATATTACATGCAAGG - Intergenic
980589510 4:134866949-134866971 CTTAATATATTATAAATGTATGG + Intergenic
980880171 4:138701857-138701879 GTTAGAATATATTAAATGGATGG - Intergenic
981168012 4:141585086-141585108 CTGAGTATATATCTAAAGTATGG - Intergenic
981536048 4:145800854-145800876 CCCAGGATACATTAGATGTATGG - Intronic
981704100 4:147641010-147641032 CTCAATATATTTTAAAGGTAGGG - Intronic
981775411 4:148361741-148361763 CTCAGTAACCATTAAAAGTAAGG - Intronic
983046519 4:162993607-162993629 CTCAGCATAAATTAGATCTAAGG + Intergenic
983280463 4:165674687-165674709 ATAAGTATAAATTATATGTAAGG - Intergenic
984088183 4:175337831-175337853 CTCAGTATATTGTAATTTTAAGG + Intergenic
985197427 4:187447094-187447116 CTCAGTATTCATCAAAGGTAAGG - Intergenic
986960701 5:13207640-13207662 CTATATATATATTAAATGCAAGG + Intergenic
987303041 5:16614133-16614155 GTCAGTATAAATAAAATGGATGG + Intronic
987448181 5:18047692-18047714 CTCAGCATATTTTTAATATATGG - Intergenic
987830933 5:23093902-23093924 GTGAGTTTATATGAAATGTATGG - Intergenic
988221944 5:28357350-28357372 CTCAATATATATTCATTGAAGGG + Intergenic
988510402 5:31859851-31859873 CTCAGCAAATATTACATGTATGG - Intronic
988630695 5:32928261-32928283 CTCCATATATATTAAAGGCAAGG - Intergenic
989019610 5:36987174-36987196 CTCAGTATATTTAGACTGTATGG - Intronic
989465556 5:41751182-41751204 CTTGATTTATATTAAATGTAAGG - Intronic
990931784 5:61099959-61099981 TTCAGTATATGACAAATGTATGG - Intronic
991168805 5:63595877-63595899 CTCATGATAAATTTAATGTAGGG + Intergenic
993243712 5:85424778-85424800 CTCAGTTTATATTGAATATTGGG - Intergenic
995303510 5:110614427-110614449 CTTAGTATTTTATAAATGTAGGG - Intronic
995586412 5:113653330-113653352 CTCATTATATACTAATTATAAGG - Intergenic
996074895 5:119180830-119180852 CTCAGAACATATTAAAAATATGG - Intronic
996917348 5:128728310-128728332 CCCAGTGTATATTAATTGTGTGG + Intronic
996939988 5:128992937-128992959 CTCAGTAAATATTTATTGAATGG + Intronic
997059628 5:130485992-130486014 TTGAGTATATATTATATGTCAGG + Intergenic
997220951 5:132163478-132163500 CTCAGTGTATATTATATGCCAGG - Intergenic
998762312 5:145446197-145446219 ATCACTATATATAATATGTATGG + Intergenic
999163183 5:149522932-149522954 CTCAATACATGTTCAATGTATGG + Intronic
999479096 5:151928834-151928856 CTCAGTAAATATTTATTGCAAGG + Intergenic
999760267 5:154694753-154694775 CTCACTATATATAAAATCTGTGG - Intergenic
1000122279 5:158208731-158208753 CACAGTATTAATTAAATGAATGG - Intergenic
1000488414 5:161878125-161878147 CTCAGTAAATATTTATTGAATGG + Intronic
1000783619 5:165514979-165515001 ATCAGAATATCTCAAATGTAGGG - Intergenic
1004009858 6:11673476-11673498 ATCATTATATTTTAAAGGTATGG - Intergenic
1004285838 6:14319855-14319877 TTCAGTGTATATTATATGTGCGG - Intergenic
1004302042 6:14467257-14467279 CTCAGTAGTTTTTAAATGTGAGG - Intergenic
1004318284 6:14611194-14611216 CTGAGTATATAGTCAATGTATGG + Intergenic
1005197057 6:23299873-23299895 TTAAGTATATCTTAAATGTTAGG - Intergenic
1010053284 6:71533175-71533197 ATTAGTATATATTAAATTTGGGG + Intergenic
1010756238 6:79669111-79669133 CTCAATAAATATTAACTGAATGG - Intronic
1011837158 6:91446789-91446811 CTCAGTTTAAATTAAATTTTAGG + Intergenic
1012109733 6:95214293-95214315 CATGGTATATATTAAATGAAGGG - Intergenic
1012137987 6:95582776-95582798 TACACTATATATAAAATGTATGG - Intronic
1012537449 6:100315965-100315987 ATCAATATATATTCTATGTAGGG - Intergenic
1014323020 6:119955486-119955508 CTCAGTATATAAATATTGTAAGG + Intergenic
1014326331 6:120000133-120000155 TTGAGAATATATTAAATGTCAGG + Intergenic
1016328442 6:142929364-142929386 CTCAGTCTATACTAAATTTATGG - Intronic
1016703804 6:147083222-147083244 CTCAGGCAATATTAAGTGTAGGG + Intergenic
1016800001 6:148158719-148158741 TTGAGTATCTATTAAATGTAAGG - Intergenic
1017672829 6:156783079-156783101 CTCATTATAGATTCAAGGTAAGG - Intronic
1018630619 6:165818971-165818993 TTCAATGTATATAAAATGTAAGG + Intronic
1020375522 7:7480625-7480647 CACAATTTATATTAAATGTAAGG + Intronic
1020459373 7:8411637-8411659 ATCAGTATTAATTAAATGGATGG - Intergenic
1020516630 7:9129346-9129368 TTCTGTATATGTTAAATGTATGG - Intergenic
1020780162 7:12507686-12507708 CTCATTATATAGTAAATGTGGGG + Intergenic
1020962178 7:14819152-14819174 CTCTGTATGTATTAGATGAATGG - Intronic
1020970123 7:14926343-14926365 CTCATTATATATCAAAAGCAAGG - Intronic
1020971109 7:14940174-14940196 CTCAGCAAATATTTAATGAATGG + Intronic
1021384028 7:20006097-20006119 ATGACTATAGATTAAATGTACGG - Intergenic
1022826688 7:34021834-34021856 CTCAATAAATATTCAATGGATGG - Intronic
1022945192 7:35276872-35276894 ATGAGGATATATTGAATGTAAGG - Intergenic
1023221960 7:37928800-37928822 TTCAGTATATATCAAAATTAGGG - Intronic
1026298035 7:69073012-69073034 CACTGTGTATATTAAATGTATGG - Intergenic
1027491418 7:78832444-78832466 TTCAGTACATAGTAATTGTAAGG + Intronic
1027580840 7:79993402-79993424 ATCAGTATATTTAAATTGTATGG - Intergenic
1027863710 7:83619160-83619182 CTTATTATGTATTAAATTTATGG + Intronic
1027900522 7:84108423-84108445 GTCTGTATATTTTAAATGCAAGG - Intronic
1028039461 7:86030922-86030944 ATCACTATATATTATATGCATGG + Intergenic
1028393495 7:90341387-90341409 CTCAGTATGTAACAAATGTTGGG - Intronic
1028407874 7:90495936-90495958 CTCAGTATCTATTAAAATTTGGG + Intronic
1028790993 7:94852980-94853002 ATCACTATACATTACATGTATGG - Intergenic
1029804737 7:102984382-102984404 CTCAATATATATCTAATGGATGG - Intronic
1030964573 7:115974639-115974661 CTCTGTACATATTAACTATAGGG - Intronic
1031049424 7:116930007-116930029 GCCAGAATATATTAAATGTGTGG - Intergenic
1031693929 7:124825828-124825850 CTCATTAAATATTTAATGAAAGG + Intronic
1031917581 7:127577642-127577664 CTCAGTTAATATAAAATGTATGG + Intergenic
1032647832 7:133845273-133845295 CTCAGTACATCTTAACTGAAGGG - Intronic
1034057010 7:148045668-148045690 CTCAGTAAATATTCACTGGAAGG - Intronic
1037231902 8:16669137-16669159 CACATCATATATTAAATGTGTGG - Intergenic
1039931810 8:41998589-41998611 CTTAGTATATACTAAGTGCAAGG - Intronic
1041572654 8:59354696-59354718 AACAGTATATATTAAATTGAAGG + Intergenic
1042025995 8:64424062-64424084 CTCAGTACATGTTAAAAGAAGGG + Intergenic
1043502039 8:80867818-80867840 CTCAGTAAATATTAATTGAATGG - Intronic
1043583729 8:81742695-81742717 CTTTATATATATTAAATATATGG - Intronic
1043585140 8:81760142-81760164 GTCAGTATTTATTAAATGAATGG + Intergenic
1043653910 8:82636668-82636690 CTCAATATACATTAAATGTCTGG - Intergenic
1043909154 8:85840376-85840398 CACAGTATATATGAACTATAGGG - Intergenic
1043977941 8:86604210-86604232 CTCTTTATATTTAAAATGTAGGG - Exonic
1044518209 8:93165225-93165247 GTCAGTATTAATTAAATGAATGG - Intronic
1045444697 8:102248590-102248612 TTCAATATATAGTAACTGTAGGG + Intergenic
1045722569 8:105131011-105131033 ATCATTATATATTAAAAGTTTGG + Intronic
1045872405 8:106941329-106941351 CTCATTACTTACTAAATGTATGG + Intergenic
1046823526 8:118661789-118661811 CTCAGCATAGAATCAATGTAGGG + Intergenic
1047117961 8:121866528-121866550 ATAAGTATATATTTAATGAATGG - Intergenic
1047500871 8:125440223-125440245 CTTAGAAGAGATTAAATGTATGG - Intergenic
1047539528 8:125751181-125751203 CTAAATAGTTATTAAATGTAAGG - Intergenic
1047567329 8:126060003-126060025 CTCAGTTTATGTTAAATTCATGG + Intergenic
1048371845 8:133785154-133785176 CTCTTTATAAATTTAATGTATGG - Intergenic
1050422474 9:5480906-5480928 ATTAGTATATATTACATGTCAGG + Intergenic
1050842108 9:10163629-10163651 CTCAGTATATTTTAAATGGTAGG + Intronic
1051138549 9:13952089-13952111 GTAAGTTTATATTAAATGGACGG + Intergenic
1051306452 9:15715465-15715487 TACATTATATATTAAATGTTTGG + Intronic
1051687993 9:19678632-19678654 CTCTGTATTTATTAATTATAGGG - Intronic
1052104860 9:24500739-24500761 CCCAGTATTTATTAAATATGAGG - Intergenic
1052442761 9:28518994-28519016 CACAGTATTTTTTAAATGTTTGG + Intronic
1052509125 9:29391496-29391518 TTCAGTTTATCATAAATGTATGG + Intergenic
1052632815 9:31062347-31062369 CTCAGTATAGGTTGAGTGTATGG + Intergenic
1052672290 9:31573640-31573662 CTCTGTATAAAATACATGTAGGG + Intergenic
1052845768 9:33335001-33335023 TTCAGCATAAATAAAATGTAGGG - Intronic
1053501121 9:38593207-38593229 TACAGTATATTTTAAATGAAAGG + Intergenic
1055041983 9:71883999-71884021 GTCAGAATATTTAAAATGTAGGG + Intronic
1055064298 9:72103095-72103117 CTAAGTACTTATTAAATGTTGGG - Intergenic
1055169282 9:73235520-73235542 CTCAATTTAAATTATATGTATGG - Intergenic
1055232656 9:74085548-74085570 CTGAGGATATTTTAAACGTAAGG - Intergenic
1055888398 9:81095233-81095255 CTCAGTAAGTATTAAATGACTGG + Intergenic
1057096414 9:92314244-92314266 GTGAGTATATTTTCAATGTATGG - Intronic
1057226130 9:93294250-93294272 CTCACTATATCCTCAATGTATGG - Intronic
1059138758 9:111832423-111832445 CTCAATATATATAAAGTGTCTGG + Intergenic
1059647488 9:116281745-116281767 CTCAGTAAATATTTATTGAATGG - Intronic
1060609873 9:124953758-124953780 TTCAGGAAATTTTAAATGTATGG - Intronic
1060850947 9:126874947-126874969 CTAAGTATGTATTAAGTGTCAGG - Intronic
1061686787 9:132287154-132287176 CTCAGTATAGCTTTAATATAAGG + Intronic
1186425747 X:9464040-9464062 CTCATTATATAGTAAAGGAAGGG + Intronic
1186507793 X:10107813-10107835 TTCTGTTTATATTATATGTATGG + Intronic
1186629170 X:11330267-11330289 CTCTGTAATTATGAAATGTATGG - Intronic
1187278914 X:17841626-17841648 CTCAATATATATTGATTGAATGG - Intronic
1187367014 X:18674304-18674326 CACAGTATAAAATAAATGTCAGG - Intergenic
1187770808 X:22693606-22693628 ATCACTATACATTATATGTATGG - Intergenic
1188489035 X:30717157-30717179 GTCAGGTAATATTAAATGTAGGG - Intronic
1189985604 X:46550868-46550890 GTCATTATATATAATATGTAGGG - Intergenic
1193377631 X:80780552-80780574 CTCACTAAATATTAAATAGATGG - Intronic
1194640640 X:96399864-96399886 CTCATTATATATTTGATGAATGG + Intergenic
1195691204 X:107627188-107627210 CTCAGTAAATATTTGATGAATGG + Intergenic
1196247057 X:113412789-113412811 CTAAGCATGTATGAAATGTAGGG - Intergenic
1197523733 X:127534112-127534134 TTGAGTATATATTATTTGTATGG - Intergenic
1198513939 X:137385271-137385293 CTCAGGATATTTTATATATATGG - Intergenic
1199531188 X:148849487-148849509 TTCAGTATCTACTACATGTAAGG + Intronic
1202016320 Y:20410507-20410529 CACAGTATATATTCTATTTATGG - Intergenic