ID: 1099214170

View in Genome Browser
Species Human (GRCh38)
Location 12:79834045-79834067
Sequence AATGTACCTGGCAAAATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1099214170_1099214172 -8 Left 1099214170 12:79834045-79834067 CCTACTATTTTGCCAGGTACATT 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG 0: 1
1: 0
2: 1
3: 11
4: 70
1099214170_1099214173 16 Left 1099214170 12:79834045-79834067 CCTACTATTTTGCCAGGTACATT 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1099214173 12:79834084-79834106 ATAGATGTGAACTTATTATATGG 0: 1
1: 0
2: 2
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1099214170 Original CRISPR AATGTACCTGGCAAAATAGT AGG (reversed) Intronic
905076112 1:35271761-35271783 GATGAAACTGGCAAAATAATGGG - Intronic
905352091 1:37354935-37354957 GATGTACCTGACACAATAATGGG + Intergenic
906008211 1:42497692-42497714 AAAATACCTGGCATAATACTAGG + Intronic
909500141 1:76325449-76325471 AATTTACCTTGCAAAAAACTTGG - Intronic
910722899 1:90306997-90307019 AAGGAACCTGGCAAAATGTTAGG - Intergenic
912115855 1:106406991-106407013 AATGCACCTGATTAAATAGTGGG - Intergenic
912505887 1:110155815-110155837 AATGTAACTGGCAGAATTTTGGG - Intronic
914951687 1:152120890-152120912 ATTGTACCTGGCAGGATACTCGG + Intergenic
914976875 1:152373982-152374004 AATGTACCTGGCAATTTCATGGG + Intergenic
914993502 1:152518531-152518553 TATGTACCTGGCATGATACTAGG - Intronic
916812869 1:168320950-168320972 AATGTACCCCGCCAAATACTTGG + Intergenic
917770542 1:178272637-178272659 ACCGTGCCTGGCCAAATAGTTGG - Intronic
920957287 1:210631105-210631127 AATATTCCAGGAAAAATAGTTGG - Intronic
922018546 1:221678257-221678279 ATTTTACATGGCAAAAGAGTTGG + Intergenic
923375283 1:233355931-233355953 AGTGAACATGGCAAAAAAGTGGG - Intronic
923443580 1:234045683-234045705 AATGAACGTGGCACAATAATAGG - Intronic
924053289 1:240099116-240099138 CATGTACCAGGCAGAATTGTAGG - Intronic
1064807708 10:19155833-19155855 AAAGCACCTGGCAAAATATTTGG + Intronic
1069034000 10:63629641-63629663 AATGTGCCTGGAATAATAATAGG - Intergenic
1072089163 10:92110151-92110173 AATGTGCATGGGGAAATAGTTGG - Intronic
1072935519 10:99708825-99708847 ATTGTAGCTGACAAAGTAGTTGG - Intronic
1073823608 10:107293233-107293255 AATGTACCTGGCAACCTTATGGG - Intergenic
1075701838 10:124474919-124474941 AATGTACCTGCCCCAACAGTGGG + Intronic
1079105733 11:17571231-17571253 AGGGTAGCTGGCCAAATAGTAGG + Intronic
1080302837 11:30803620-30803642 AATGCATCTGGGAAATTAGTTGG - Intergenic
1081435947 11:43027628-43027650 AAAGTATCTAGCAGAATAGTTGG - Intergenic
1082136549 11:48555430-48555452 AATGGACCTGGTACCATAGTTGG + Intergenic
1082212135 11:49517936-49517958 AAGCAACCTGGCATAATAGTAGG + Intergenic
1086172996 11:83857914-83857936 TAAATACCTGGTAAAATAGTAGG + Intronic
1086256288 11:84880476-84880498 AATATACCTTTCAAAATATTCGG - Intronic
1086637453 11:89106577-89106599 AAGCAACCTGGCATAATAGTAGG - Intergenic
1086914671 11:92515772-92515794 ATTGTACCTGTCAAAATACCAGG + Intronic
1088619742 11:111670067-111670089 AATGTACAGTTCAAAATAGTCGG - Intronic
1090011071 11:123046423-123046445 AAGGGACCTGGTAAAATGGTGGG + Intergenic
1090104886 11:123842243-123842265 AATTTAGCTGGGAAAGTAGTAGG - Intergenic
1091125629 11:133092982-133093004 AAAGTGCCTAGGAAAATAGTGGG - Intronic
1093617576 12:21246228-21246250 AATGTAGCAGGCAAAACAGCAGG + Intergenic
1094238103 12:28191027-28191049 AATGTACTTGGCAAAGTAAAAGG - Intronic
1094660757 12:32468304-32468326 AGTGTAACTTGCAAAAGAGTTGG + Intronic
1097958492 12:65510433-65510455 AATGTACCATGCAAAGTACTAGG - Intergenic
1098548604 12:71738567-71738589 AATGTGCCAGGCACTATAGTAGG + Intergenic
1098584427 12:72139092-72139114 GATGTACCTGGTAATATATTAGG + Intronic
1099214170 12:79834045-79834067 AATGTACCTGGCAAAATAGTAGG - Intronic
1100356040 12:93830918-93830940 AATGTACTTGGCAATATAGCAGG + Intronic
1100511200 12:95275967-95275989 AATATACTTGGCAAAATGGTCGG - Intronic
1101657043 12:106731642-106731664 AATGTACCTGACATAATTCTAGG - Intronic
1107774769 13:43826166-43826188 AATGTACCTTACCAAATAATGGG - Intronic
1109428667 13:62201871-62201893 AATATACCTGCCAAAAAAGATGG + Intergenic
1111699096 13:91663233-91663255 ACTAAACCTGGCAAAATATTAGG - Intronic
1112690465 13:101887703-101887725 ATTGTACATTTCAAAATAGTAGG + Intronic
1114720980 14:24881782-24881804 AATGTAGCTGCCAAAAGGGTGGG + Intronic
1115301737 14:31892907-31892929 AATCTACCTGGCAGAATAAAGGG - Intergenic
1115623556 14:35165967-35165989 AGTGTACCTGGCCAAAAAGTAGG + Intronic
1116046197 14:39746046-39746068 CATGAACCTGACAGAATAGTGGG - Intergenic
1119560688 14:75587086-75587108 AAAGTACCTTGCATAATAGTGGG - Intronic
1125634460 15:41175688-41175710 ATTGTACCTTTCAAAATAGCTGG - Intergenic
1126839994 15:52708585-52708607 AATCTACCTTGCAAAACTGTTGG + Intronic
1128836565 15:70813627-70813649 AATGCTCCTGGAATAATAGTCGG - Intergenic
1129016398 15:72473208-72473230 AGGGTACATGGCAAAATATTAGG - Intergenic
1130604525 15:85303678-85303700 AAGGTATCTTGCAAAATAATAGG + Intergenic
1131020998 15:89098657-89098679 AATGTACCCTTCTAAATAGTGGG + Intronic
1131122630 15:89832152-89832174 ACTGGACCTGGCCAAATACTGGG - Exonic
1131736884 15:95342317-95342339 AATGTACATTTTAAAATAGTGGG - Intergenic
1134796052 16:17038129-17038151 AATGTCCCTAGCAAATAAGTGGG - Intergenic
1135180745 16:20272126-20272148 ACAGTACCTGGCACATTAGTAGG - Intergenic
1135248302 16:20877058-20877080 AATGTACATTTCAAAATAGGTGG + Intronic
1137682598 16:50363723-50363745 AATGTACCTTGCTAAAAATTAGG - Intronic
1137713078 16:50580404-50580426 AATGCAACTGGCATAATAGCAGG + Intronic
1139124127 16:64057255-64057277 AAAGTACCTAGCACAATACTTGG - Intergenic
1139243711 16:65420165-65420187 CATGTAACTGGCAAATTAGCTGG + Intergenic
1139818993 16:69704813-69704835 ACTCTACCTGGCAAAATGGTAGG - Intergenic
1140131126 16:72162760-72162782 AATGTACCTGGCAACTTGGAAGG - Intronic
1145089580 17:19975945-19975967 AATGAAACCGGTAAAATAGTAGG - Intronic
1154041652 18:10861715-10861737 AATGTATATTTCAAAATAGTTGG + Intronic
1156786776 18:40924490-40924512 AATTTACCTGGGTACATAGTAGG + Intergenic
1157180395 18:45492651-45492673 AATGTGCCTAGCTAAAAAGTTGG + Intronic
1157634968 18:49143461-49143483 AAAGTACTTAGCAAAATATTTGG - Intronic
1160897843 19:1411085-1411107 AAGGCACCTGGCAAGATTGTTGG + Intronic
1167070046 19:47216276-47216298 ACTGCAAGTGGCAAAATAGTGGG - Intergenic
1167531289 19:50018846-50018868 AATTTACCTGGGTACATAGTAGG - Intronic
1168619011 19:57862061-57862083 ACTGTACCTGGCTGAATACTTGG + Exonic
926915366 2:17886309-17886331 AATGTAACTGGCCAAAGAGATGG + Intronic
926950191 2:18234340-18234362 AATGTAACTGTTAAAATGGTAGG + Intronic
927493643 2:23537524-23537546 AATGCACCTGACATAATATTGGG - Intronic
928567449 2:32567791-32567813 GATGTACCAGGTAAAAGAGTGGG + Intronic
929901705 2:46009884-46009906 ACTGTAACTGTAAAAATAGTTGG + Intronic
931359175 2:61563773-61563795 AGAGTACCTGGCCAAATAGTAGG + Intergenic
932160217 2:69453087-69453109 ACTGTGCCTGGCAGAACAGTGGG - Intergenic
936848442 2:116867112-116867134 AGTGAACCTGGCAGAATGGTAGG + Intergenic
937086054 2:119172585-119172607 AATCTTCCTGCCAAAATACTGGG - Intergenic
937621993 2:123999154-123999176 AATTTAGTTGGCAAAATATTTGG - Intergenic
941004732 2:160236315-160236337 TATGTAGCTGGCAAAAGAGAAGG + Intronic
943161328 2:184255687-184255709 AATGTTTCAGGCAAAATATTGGG + Intergenic
943706071 2:191036024-191036046 TCTGTGCCTGGCAATATAGTAGG + Intronic
945594519 2:211775218-211775240 CACCTATCTGGCAAAATAGTGGG - Intronic
945757534 2:213867353-213867375 AATGTACATTGCCAAAAAGTGGG + Intronic
946673360 2:222130038-222130060 AGTGTACCTGGCAAAAGTCTAGG - Intergenic
1169011886 20:2257960-2257982 ACTGTGCCAGGCAAAATGGTTGG - Intergenic
1171878872 20:30601943-30601965 TATGTACCAGGCACAGTAGTAGG - Intergenic
1173317455 20:41957928-41957950 AAGGTGCCTGGCAAAATAAATGG - Intergenic
1175361827 20:58418001-58418023 TAGGTACCTGGTGAAATAGTGGG + Intronic
1175469226 20:59214576-59214598 ACTCTAACTGGGAAAATAGTGGG - Intronic
1177240972 21:18456442-18456464 AATGTAACTGGCAAAATAAGTGG - Intronic
950898302 3:16473694-16473716 ACTGCACCTGGCCAAATACTCGG + Intronic
951264968 3:20553922-20553944 AATGTCACTGGAACAATAGTAGG - Intergenic
951382638 3:22003575-22003597 ACTGTACCTGGCCAAATTTTAGG - Intronic
951576102 3:24115806-24115828 TATGTACCTGGCCAAAGAGCAGG - Intergenic
952052893 3:29407610-29407632 TAAGTACCTGGCTAAATGGTTGG - Intronic
952095505 3:29947136-29947158 AATGTAGTTAGCAAAATACTTGG + Intronic
952817705 3:37459963-37459985 AATGTCCCTGGCAGAATCATTGG - Intronic
953252745 3:41261491-41261513 TAAGTACCTGGCAAAGTTGTTGG + Intronic
953609261 3:44433862-44433884 ACTGCACCTGGCAAAATAGCCGG + Intergenic
957159535 3:76591704-76591726 CATATACCAGGCAAAATAATTGG + Intronic
957174667 3:76791138-76791160 AGTGTACCTTGCAGAATAGTTGG + Intronic
958130705 3:89417990-89418012 AATGTAGCTGGCAAATCAATAGG + Intronic
962080208 3:132130605-132130627 AATGTGCCTGGCGAAGTACTTGG + Intronic
964100838 3:152986286-152986308 AATGTAAATGACAAATTAGTGGG + Intergenic
965226046 3:165992318-165992340 AATGTAACTGGCTAAAAATTAGG - Intergenic
970596754 4:17607323-17607345 AATGTACTTAGCAAAAATGTGGG + Intronic
970628345 4:17914528-17914550 AAAGGACCTGGCAAAAGAGAGGG + Intronic
970846458 4:20544068-20544090 AATGTAAATGGCAAGTTAGTGGG + Intronic
971778700 4:31002798-31002820 AATGCACATGTCAAAATATTTGG - Intronic
974208530 4:58739525-58739547 AATCTACATGTCAAAATAGTTGG + Intergenic
974510905 4:62839311-62839333 AATGTCCCTGTCAAATTAATAGG + Intergenic
975436908 4:74364358-74364380 AATTTGCCTGGGGAAATAGTGGG + Intergenic
975482237 4:74893748-74893770 AATTTACCTGTCAAAAAATTGGG - Intergenic
979078029 4:116299127-116299149 CATCTATGTGGCAAAATAGTTGG + Exonic
979224778 4:118272373-118272395 AATCTACCAGGAAAAACAGTAGG - Intergenic
980424245 4:132605899-132605921 AATTTATGTGGCAAAAGAGTGGG + Intergenic
980561936 4:134489202-134489224 AAAGAACCTGGGAAAATAGAAGG - Intergenic
980781018 4:137492454-137492476 AATGTACATTCCAAAAAAGTGGG - Intergenic
982443668 4:155465158-155465180 CACCTACATGGCAAAATAGTGGG - Intergenic
983616969 4:169717977-169717999 AATGTAATTGGCAGCATAGTAGG - Intronic
987452774 5:18106920-18106942 AAAGTACCTGGCACAATATTTGG + Intergenic
988788481 5:34585649-34585671 AGAGATCCTGGCAAAATAGTGGG + Intergenic
988885320 5:35550919-35550941 AATGTACCTTGCAAATGACTTGG - Intergenic
990863199 5:60351309-60351331 AATATACCTAGCAAAAAAATGGG - Intronic
992860831 5:80907913-80907935 AATGTAACTGTTAATATAGTTGG - Intergenic
994323173 5:98416422-98416444 AATGTTTCTATCAAAATAGTAGG - Intergenic
999884693 5:155908873-155908895 AATCTACCTTGCACCATAGTAGG + Intronic
1000245609 5:159446378-159446400 AATGTAGCGGGGAGAATAGTGGG + Intergenic
1002545951 5:179945280-179945302 ACTGCACCTGGGAAAACAGTGGG + Intronic
1008007466 6:46426499-46426521 AATCTGCATGGGAAAATAGTAGG + Intronic
1008421681 6:51308200-51308222 TATGTACCTGGCAAAATACATGG - Intergenic
1008708554 6:54195050-54195072 ATTCTACCAGGCAAAATTGTGGG - Intronic
1011197674 6:84798922-84798944 AGTGTATCTGGCAAAATATAGGG + Intergenic
1013934952 6:115582889-115582911 AATGCACCTGGAAGAACAGTAGG - Intergenic
1014392850 6:120885398-120885420 AATAAACATGGCAAAACAGTGGG - Intergenic
1021562093 7:21978750-21978772 AGGGTAACTGGCAAAATATTTGG + Intergenic
1022595553 7:31710237-31710259 AATGGAACTGGCAAAGCAGTTGG + Intergenic
1023911188 7:44558124-44558146 AATGAACTTGGCAAAATTATAGG + Intergenic
1028776482 7:94683212-94683234 CATGTACCTGTTAAAATAGGTGG - Intergenic
1031119063 7:117699913-117699935 AATTGACCTGGAAAAAGAGTGGG + Intronic
1031388409 7:121181990-121182012 AATGAACCTGGGAAACTAGGGGG + Intronic
1031880738 7:127195636-127195658 AGTGTTCCTGGGAAAATGGTGGG - Intronic
1032434825 7:131891492-131891514 CATGTACCTGCCAAAATACCTGG + Intergenic
1035108332 7:156460307-156460329 AATGTAGCTTCCAAAGTAGTGGG - Intergenic
1035180366 7:157085005-157085027 CATGTACCTGGAAAAACAGTAGG + Intergenic
1036806948 8:11841643-11841665 AATGTACCTGGGAAACTACCTGG + Intergenic
1037131903 8:15416773-15416795 AATGTACAAGGCAAAATGTTTGG + Intergenic
1037208884 8:16361188-16361210 AATGTGACAGGGAAAATAGTAGG + Intronic
1037341980 8:17855551-17855573 ACTGTGTCTGGCAACATAGTAGG - Intergenic
1039540366 8:38362186-38362208 AATGTGCCAGGCACTATAGTTGG - Intronic
1042635845 8:70873366-70873388 GATGGACCTGGCAAAATAAATGG + Intergenic
1043798465 8:84577233-84577255 AATGTACCTTGCAAAATATGTGG - Intronic
1050386106 9:5092737-5092759 CACCTACGTGGCAAAATAGTGGG + Intronic
1050785628 9:9398042-9398064 AGTGTACAAGGGAAAATAGTGGG - Intronic
1057994435 9:99807780-99807802 AATGAACCTGGCAAATGAGAAGG - Intergenic
1058153027 9:101482648-101482670 AATGCAGCTGGGAAGATAGTTGG - Intronic
1061442100 9:130612478-130612500 AAAGTGCCTGACAAAATGGTTGG + Exonic
1062226369 9:135454543-135454565 AATGCACCTGACAAACTTGTGGG - Intergenic
1186581923 X:10828859-10828881 AACGTACCTGGCACAATGCTGGG - Intronic
1186778147 X:12886166-12886188 AAAGTAGATGGCAAAACAGTAGG - Exonic
1187026382 X:15439659-15439681 AATGTGCCTAGCAACATAGAGGG - Intronic
1187357001 X:18585072-18585094 TATGTGCCTGGCAAAGTGGTTGG - Intronic
1187725706 X:22200072-22200094 AAAGTACCTGGCATAATGGTTGG - Intronic
1188440670 X:30212948-30212970 AAAGCACCTGGCACAATACTTGG - Intergenic
1188905874 X:35790957-35790979 AGTGTACCTGGAAAACTGGTGGG + Intergenic
1188973138 X:36641561-36641583 AATTTACGTGGGCAAATAGTAGG + Intergenic
1190808659 X:53863184-53863206 AATGTTTCTGGCAAAATGGTAGG - Intergenic
1193602822 X:83529317-83529339 AATGTACCTGGCAAAGTGTGTGG + Intergenic
1194628232 X:96250794-96250816 TATGTATCTTCCAAAATAGTAGG + Intergenic
1195071259 X:101282571-101282593 AATGTACATTACAAAATACTTGG - Intronic
1195437409 X:104861311-104861333 CATGTGCCTGGCCACATAGTGGG - Intronic
1195839615 X:109158731-109158753 AATGTATCTAACAAAATAATAGG + Intergenic
1199002774 X:142659523-142659545 ACTTTACCTGGAAACATAGTTGG + Intergenic